Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T75243 Target Info
Target Name Serine/threonine-protein kinase mTOR (mTOR)
Synonyms Target of rapamycin; TOR kinase; Rapamycin target protein 1; Rapamycin target protein; Rapamycin and FKBP12 target 1; RAPT1; RAFT1; Mechanistic target of rapamycin; Mammalian target of rapamycin; FRAP2; FRAP1; FRAP; FKBP12-rapamycin complex-associated protein; FKBP-rapamycin associated protein; FK506-binding protein 12-rapamycin complex-associated protein 1
Target Type Successful Target
Gene Name MTOR
Biochemical Class Kinase
UniProt ID
P42345
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-99a-5p miRNA Info
miRNA Mature AC
MIMAT0000097
Sequence aacccguagauccgaucuugug
miRNA Species Homo sapiens
Regulation Mechanism Mammalian target of rapamycin (mTOR) was further characterized as the direct target of miR-99a. [15]
Evidence Score (E-score) 17 +
1 ChIP; Immunohistochemistry; Immunoprecipitation; qRT-PCR; Western Blot [1]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [2]
3 Immunohistochemistry; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
8 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
9 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
10 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
11 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
12 Luciferase Reporter Assay; qRT-PCR; Western Blot [12]
13 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
14 Luciferase Reporter Assay; qRT-PCR; Western Blot [14]
15 Luciferase Reporter Assay; Western Blot [15]
16 Luciferase Reporter Assay; Western Blot [16]
17 Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism mTOR gene was a direct target of miR-100. siRNA-mediated mTOR knockdown phenocopied the effect of miR-100 in bladder cancer cell lines. [15]
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay [18]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [15]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
5 qRT-PCR; Western Blot [19]
6 Western Blot [20]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism mTOR is a direct target of miR-144. [22]
Evidence Score (E-score) 3 +
1 Immunofluorescence; Western Blot [21]
2 Luciferase Reporter Assay [22]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [23]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-99b-5p miRNA Info
miRNA Mature AC
MIMAT0000689
Sequence cacccguagaaccgaccuugcg
miRNA Species Homo sapiens
Regulation Mechanism miR-99a/b negatively regulated mTOR expression by binding to the 3'UTR, thereby resulting in suppression of cervical cancer cell proliferation and invasion. [6]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [24]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
3 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
NADPH oxidase 4 (NOX4) Target Info
NOX4_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism miRNAs let-7 targets the mTOR mRNA. [25]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [25]
2 qRT-PCR [26]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-193a-5p miRNA Info
miRNA Mature AC
MIMAT0004614
Sequence ugggucuuugcgggcgagauga
miRNA Species Homo sapiens
Regulation Mechanism mTOR is a direct target of miR-193a-5p. [27]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [27]
2 Western Blot [27]
Representative Target(s) Regulated by This miRNA AP-2 transcription factor (TFAP2A) Target Info
AP2A_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-496 miRNA Info
miRNA Mature AC
MIMAT0002818
Sequence ugaguauuacauggccaaucuc
miRNA Species Homo sapiens
Regulation Mechanism miRNA-496 targets 2 sites within the mTOR 3'UTR. [28]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [28]
2 RT-PCR [29]
Representative Target(s) Regulated by This miRNA Serine/threonine-protein kinase mTOR (mTOR) Target Info
MTOR_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-125a-5p resulted in decreased potein and mRNA level of mTOR. [30]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [30]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-196b-5p miRNA Info
miRNA Mature AC
MIMAT0001080
Sequence uagguaguuuccuguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism Upregulation of miR-196b promotes the proliferation and invasion ability of gastric cancer cells by regulating the PI3K/AKT/mTOR pathway. [31]
Evidence Score (E-score) 1 +
1 Western Blot [31]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism mTOR was a direct target of mIR-224. [32]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [32]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Regulation Mechanism miR-373 increased the expression of MMP9 by directly targeting the 3'UTR of mTOR and suppressing their translation. [33]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [33]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-497 targets the mTOR. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-520c-3p miRNA Info
miRNA Mature AC
MIMAT0002846
Sequence aaagugcuuccuuuuagagggu
miRNA Species Homo sapiens
Regulation Mechanism miR-520 increased the expression of MMP9 by directly targeting the 3'UTR of mTOR and suppressing their translation. [33]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [33]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-199a-3p miRNA Info
miRNA Mature AC
MIMAT0000232
Sequence acaguagucugcacauugguua
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-199a-3p by Anti-miRNA resulted in the changed protein level of target mTOR. [35]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [35]
Representative Target(s) Regulated by This miRNA Serine/threonine-protein kinase mTOR (mTOR) Target Info
MTOR_HUMAN
miRNA Mature ID hsa-miR-3188 miRNA Info
miRNA Mature AC
MIMAT0015070
Sequence agaggcuuugugcggauacgggg
miRNA Species Homo sapiens
Regulation Mechanism miR-3188 directly targets mTOR. [36]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [36]
Representative Target(s) Regulated by This miRNA Serine/threonine-protein kinase mTOR (mTOR) Target Info
MTOR_HUMAN
References  Top
REF 1 Long noncoding RNA ANRIL indicates a poor prognosis of gastric cancer and promotes tumor growth by epigenetically silencing of miR-99a/miR-449a. Oncotarget. 2014 Apr 30;5(8):2276-92.
REF 2 miR-99a directly targets the mTOR signalling pathway in breast cancer side population cells. Cell Prolif. 2014 Dec;47(6):587-95.
REF 3 PLGA-based dual targeted nanoparticles enhance miRNA transfection efficiency in hepatic carcinoma. Sci Rep. 2017 Apr 7;7:46250.
REF 4 A dual PI3K/AKT/mTOR signaling inhibitor miR-99a suppresses endometrial carcinoma. Am J Transl Res. 2016 Feb 15;8(2):719-31.
REF 5 MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells. PLoS One. 2013 Dec 3;8(12):e80625.
REF 6 miR-99a and -99b inhibit cervical cancer cell proliferation and invasion by targeting mTOR signaling pathway. Med Oncol. 2014 May;31(5):934.
REF 7 MiR-99a antitumor activity in human breast cancer cells through targeting of mTOR expression. PLoS One. 2014 Mar 17;9(3):e92099.
REF 8 MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. Br J Cancer. 2013 Oct 15;109(8):2189-98.
REF 9 Clinic significance of microRNA-99a expression in human lung adenocarcinoma. J Surg Oncol. 2013 Sep;108(4):248-55.
REF 10 MicroRNA-99a/100 promotes apoptosis by targeting mTOR in human esophageal squamous cell carcinoma. Med Oncol. 2013 Mar;30(1):411.
REF 11 MicroRNA-99a induces G1-phase cell cycle arrest and suppresses tumorigenicity in renal cell carcinoma. BMC Cancer. 2012 Nov 23;12:546.
REF 12 Downregulation of microRNA 99a in oral squamous cell carcinomas contributes to the growth and survival of oral cancer cells. Mol Med Rep. 2012 Sep;6(3):675-81.
REF 13 MIR-99a and MIR-99b modulate TGF- induced epithelial to mesenchymal plasticity in normal murine mammary gland cells. PLoS One. 2012;7(1):e31032.
REF 14 MicroRNA-99a inhibits hepatocellular carcinoma growth and correlates with prognosis of patients with hepatocellular carcinoma. J Biol Chem. 2011 Oct 21;286(42):36677-85.
REF 15 Regulation of insulin-like growth factor-mammalian target of rapamycin signaling by microRNA in childhood adrenocortical tumors. Cancer Res. 2010 Jun 1;70(11):4666-75.
REF 16 Insulin promotes glucose consumption via regulation of miR-99a/mTOR/PKM2 pathway. PLoS One. 2013 Jun 10;8(6):e64924.
REF 17 MicroRNA-mediated downregulation of mTOR/FGFR3 controls tumor growth induced by Src-related oncogenic pathways. Oncogene. 2011 Aug 11;30(32):3489-501.
REF 18 miRNA-100 inhibits human bladder urothelial carcinogenesis by directly targeting mTOR. Mol Cancer Ther. 2013 Feb;12(2):207-19.
REF 19 MicroRNA 100: a context dependent miRNA in prostate cancer. Clinics (Sao Paulo). 2013 Jun;68(6):797-802.
REF 20 MicroRNA 100 sensitizes luminal A breast cancer cells to paclitaxel treatment in part by targeting mTOR. Oncotarget. 2016 Feb 2;7(5):5702-14.
REF 21 MicroRNA-144-3p inhibits proliferation and induces apoptosis of human salivary adenoid carcinoma cells via targeting of mTOR. Biotechnol Lett. 2016 Mar;38(3):409-16.
REF 22 Downregulation of miR-144 is associated with colorectal cancer progression via activation of mTOR signaling pathway. Carcinogenesis. 2012 Dec;33(12):2391-7.
REF 23 MiR-144 inhibits cell proliferation of renal cell carcinoma by targeting MTOR. J Huazhong Univ Sci Technolog Med Sci. 2016 Apr;36(2):186-192.
REF 24 miRNA-99b-5p suppresses liver metastasis of colorectal cancer by down-regulating mTOR. Oncotarget. 2015 Sep 15;6(27):24448-62.
REF 25 microRNA-mediated regulation of mTOR complex components facilitates discrimination between activation and anergy in CD4 T cells. J Exp Med. 2014 Oct 20;211(11):2281-95.
REF 26 MicroRNAs as biomarkers for major depression: a role for let-7b and let-7c. Transl Psychiatry. 2016 Aug 2;6(8):e862.
REF 27 MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene. 2015 Jan 22;34(4):413-23.
REF 28 microRNA-496 - A new, potentially aging-relevant regulator of mTOR. Cell Cycle. 2016;15(8):1108-16.
REF 29 miR-496, miR-1185, miR-654, miR-3183 and miR-495 are downregulated in colorectal cancer cells and have putative roles in the mTOR pathway. Oncol Lett. 2019 Aug;18(2):1657-1668.
REF 30 miR-125a inhibits the migration and invasion of liver cancer cells via suppression of the PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2015 Aug;10(2):681-686.
REF 31 miR-196b regulates gastric cancer cell proliferation and invasion via PI3K/AKT/mTOR signaling pathway. Oncol Lett. 2016 Mar;11(3):1745-1749.
REF 32 MicroRNA-224 aggrevates tumor growth and progression by targeting mTOR in gastric cancer. Int J Oncol. 2016 Sep;49(3):1068-80.
REF 33 miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-B factor in human fibrosarcoma cells. J Cell Physiol. 2012 Feb;227(2):867-76.
REF 34 MiR-497 decreases cisplatin resistance in ovarian cancer cells by targeting mTOR/P70S6K1. Oncotarget. 2015 Sep 22;6(28):26457-71.
REF 35 MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells. Cancer Res. 2010 Jun 15;70(12):5184-93.
REF 36 miR-3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1-modulated positive feedback loop with mTOR-p-PI3K/AKT-c-JUN. Nat Commun. 2016 Apr 20;7:11309.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.