miRNA General Information
miRNA Mature ID hsa-miR-99b-5p
miRNA Stemloop AC MI0000746
miRNA Stemloop ID hsa-mir-99b
Sequence cacccguagaaccgaccuugcg
TTD Target(s) Regulated by This miRNA Serine/threonine-protein kinase mTOR (mTOR) Successful Target Target Info [1]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [2]
NADPH oxidase 4 (NOX4) Clinical trial Target Target Info [3]
Protein(s) Regulated by This miRNA AT-rich interactive domain-containing protein 3A Regulated Protein [4]
Grainyhead-like protein 1 homolog Regulated Protein [5]
Ribonucleoprotein PTB-binding 2 Regulated Protein [6]
Serine/threonine-protein phosphatase PP1-beta catalytic subunit Regulated Protein [5]
References
REF 1 miR-99a and -99b inhibit cervical cancer cell proliferation and invasion by targeting mTOR signaling pathway. Med Oncol. 2014 May;31(5):934.
REF 2 miR-99b suppresses IGF-1R expression and contributes to inhibition of cell proliferation in human epidermal keratinocytes. Biomed Pharmacother. 2015 Oct;75:159-64.
REF 3 Chronic administration of 9-tetrahydrocannabinol induces intestinal anti-inflammatory microRNA expression during acute simian immunodeficiency virus infection of rhesus macaques. J Virol. 2015 Jan 15;89(2):1168-81.
REF 4 ZEB1 induced miR-99b/let-7e/miR-125a cluster promotes invasion and metastasis in esophageal squamous cell carcinoma.Cancer Lett. 2017 Jul 10;398:37-45.
REF 5 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 6 Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.