miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-99b-5p | ||||
miRNA Stemloop AC | MI0000746 | ||||
miRNA Stemloop ID | hsa-mir-99b | ||||
Sequence | cacccguagaaccgaccuugcg | ||||
TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [2] | ||
NADPH oxidase 4 (NOX4) | Clinical trial Target | Target Info | [3] | ||
Protein(s) Regulated by This miRNA | AT-rich interactive domain-containing protein 3A | Regulated Protein | [4] | ||
Grainyhead-like protein 1 homolog | Regulated Protein | [5] | |||
Ribonucleoprotein PTB-binding 2 | Regulated Protein | [6] | |||
Serine/threonine-protein phosphatase PP1-beta catalytic subunit | Regulated Protein | [5] | |||
References | |||||
REF 1 | miR-99a and -99b inhibit cervical cancer cell proliferation and invasion by targeting mTOR signaling pathway. Med Oncol. 2014 May;31(5):934. | ||||
REF 2 | miR-99b suppresses IGF-1R expression and contributes to inhibition of cell proliferation in human epidermal keratinocytes. Biomed Pharmacother. 2015 Oct;75:159-64. | ||||
REF 3 | Chronic administration of 9-tetrahydrocannabinol induces intestinal anti-inflammatory microRNA expression during acute simian immunodeficiency virus infection of rhesus macaques. J Virol. 2015 Jan 15;89(2):1168-81. | ||||
REF 4 | ZEB1 induced miR-99b/let-7e/miR-125a cluster promotes invasion and metastasis in esophageal squamous cell carcinoma.Cancer Lett. 2017 Jul 10;398:37-45. | ||||
REF 5 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
REF 6 | Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.