miRNA General Information
miRNA Mature ID	hsa-miR-496
miRNA Stemloop AC	MI0003136
miRNA Stemloop ID	hsa-mir-496
Sequence	ugaguauuacauggccaaucuc
TTD Target(s) Regulated by This miRNA	Serine/threonine-protein kinase mTOR (mTOR)	Successful Target	Target Info	[1]
References
REF 1	microRNA-496 - A new, potentially aging-relevant regulator of mTOR. Cell Cycle. 2016;15(8):1108-16.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.