Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T70977 Target Info
Target Name Glycogen synthase kinase-3 beta (GSK-3B)
Synonyms Serine/threonine-protein kinase GSK3B; GSK-3 beta
Target Type Clinical trial Target
Gene Name GSK3B
Biochemical Class Kinase
UniProt ID
P49841
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-224-5p increased GC sensitivity and GR protein via targeting GSK-3b in vitro. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of miR-29a expression increased PTEN expression levels, resulting in decreased phospho-Akt (p-Akt) and phospho-GSK3B (p-GSK3B) expression. PTEN and GSK3B are targeted by miR-29a, and miR-29a may contribute to ADR resistance through inhibition of the PTEN/AKT/GSK3B pathway in breast cancer cells. [4]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Western Blot [3]
2 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-29a-5p miRNA Info
miRNA Mature AC
MIMAT0004503
Sequence acugauuucuuuugguguucag
miRNA Species Homo sapiens
Regulation Mechanism miR-29a regulates tumor necrosis factor-a (TNF-a) mediated bone loss mainly by targeting DKK1, thus activating the Wnt/b-catenin pathway. [3]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
miRNA Mature ID hsa-miR-346 miRNA Info
miRNA Mature AC
MIMAT0000773
Sequence ugucugcccgcaugccugccucu
miRNA Species Homo sapiens
Regulation Mechanism A significant reduction of luciferase activity in a vector containing the target site of GSK3b, whereas cells with a mutant GSK-3b 39-UTR displayed much higher luciferase activities suggesting that GSK-3b is a direct target of miR-346. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Western Blot; RT-PCR [6]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
Interleukin-18 (IL18) Target Info
IL18_HUMAN
miRNA Mature ID hsa-miR-744-5p miRNA Info
miRNA Mature AC
MIMAT0004945
Sequence ugcggggcuagggcuaacagca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [7]
2 Western Blot [8]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
miRNA Mature ID hsa-miR-942-5p miRNA Info
miRNA Mature AC
MIMAT0004985
Sequence ucuucucuguuuuggccaugug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Regulation Mechanism Inhibition of GSK3B increases nuclear translocation of B -Catenin, which forms a complex with TCF/LEF-1 to enhance miR-182 cluster gene expression in gastric cancer cells. [10]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-183-5p miRNA Info
miRNA Mature AC
MIMAT0000261
Sequence uauggcacugguagaauucacu
miRNA Species Homo sapiens
Regulation Mechanism Inhibition of GSK3B increases nuclear translocation of B -Catenin, which forms a complex with TCF/LEF-1 to enhance miR-183 cluster gene expression in gastric cancer cells. [10]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Early growth response protein 1 (EGR-1) Target Info
EGR1_HUMAN
miRNA Mature ID hsa-miR-26a-1-3p miRNA Info
miRNA Mature AC
MIMAT0004499
Sequence ccuauucuugguuacuugcacg
miRNA Species Homo sapiens
Regulation Mechanism miR-26a directly targets GSK3B which is crucial for insulin signaling and metabolism of lipid and glucose. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-96-5p miRNA Info
miRNA Mature AC
MIMAT0000095
Sequence uuuggcacuagcacauuuuugcu
miRNA Species Homo sapiens
Regulation Mechanism Inhibition of GSK3B increases nuclear translocation of B -Catenin, which forms a complex with TCF/LEF-1 to enhance miR-96 cluster gene expression in gastric cancer cells. [10]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA 5-HT 1B receptor (HTR1B) Target Info
5HT1B_HUMAN
ALK tyrosine kinase receptor (ALK) Target Info
ALK_HUMAN
miRNA Mature ID hsa-miR-1246 miRNA Info
miRNA Mature AC
MIMAT0005898
Sequence aauggauuuuuggagcagg
miRNA Species Homo sapiens
Regulation Mechanism miR-1246 regulates the Wnt/b-catenin pathway by targeting b-catenin degradation complex members AXIN2 and GSK3B. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA cAMP-dependent protein kinase A type I (PRKAR1A) Target Info
KAP0_HUMAN
Dual-specificity tyrosine-phosphorylation regulated kinase 1A (DYRK1A) Target Info
DYR1A_HUMAN
miRNA Mature ID hsa-miR-129-1-3p miRNA Info
miRNA Mature AC
MIMAT0004548
Sequence aagcccuuaccccaaaaaguau
miRNA Species Homo sapiens
Regulation Mechanism GSK3B was a target of miR-129. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Aurora kinase A (AURKA) Target Info
AURKA_HUMAN
Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
miRNA Mature ID hsa-miR-501-5p miRNA Info
miRNA Mature AC
MIMAT0002872
Sequence aauccuuugucccugggugaga
miRNA Species Homo sapiens
Regulation Mechanism miR-501-5p maintains constitutively activated wnt/b-catenin signaling by directly targeting GSK3B, whichh promotes gastric cancer stem cell like phenotype. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
miRNA Mature ID hsa-miR-616-5p miRNA Info
miRNA Mature AC
MIMAT0003284
Sequence acucaaaacccuucagugacuu
miRNA Species Homo sapiens
Regulation Mechanism miR-616-5p directly targeted GSK3B to down regulate the Wnt/ B-catenin signal pathway. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
miRNA Mature ID hsa-miR-769-5p miRNA Info
miRNA Mature AC
MIMAT0003886
Sequence ugagaccucuggguucugagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-769 regulated cell proliferation of human melanoma by directly suppressing GSK3B expression and the knockdown of GSK3B expression reversed the effect of miR-769-in on human melanoma cell proliferation. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
miRNA Mature ID hsa-miR-99b-3p miRNA Info
miRNA Mature AC
MIMAT0004678
Sequence caagcucgugucuguggguccg
miRNA Species Homo sapiens
Regulation Mechanism miR-99b-3p functions as a tumor suppressor in OSCC via GSK3B downregulation. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
References  Top
REF 1 Circulating microRNA predicts insensitivity to glucocorticoid therapy in Graves' ophthalmopathy. Endocrine. 2015 Jun;49(2):445-56.
REF 2 MicroRNA-224 sustains Wnt/beta-catenin signaling and promotes aggressive phenotype of colorectal cancer. J Exp Clin Cancer Res. 2016 Jan 29;35:21.
REF 3 miR-29a modulates tumor necrosis factor--induced osteogenic inhibition by targeting Wnt antagonists. Dev Growth Differ. 2015 Apr;57(3):264-73.
REF 4 MicroRNA-29a contributes to drug-resistance of breast cancer cells to adriamycin through PTEN/AKT/GSK3 signaling pathway. Gene. 2016 Nov 15;593(1):84-90.
REF 5 miR-346 regulates osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by targeting the Wnt/-catenin pathway. PLoS One. 2013 Sep 4;8(9):e72266.
REF 6 miR-346 functions as a pro-survival factor under ER stress by activating mitophagy. Cancer Lett. 2018 Jan 28;413:69-81.
REF 7 MiR-744 increases tumorigenicity of pancreatic cancer by activating Wnt/beta-catenin pathway. Oncotarget. 2015 Nov 10;6(35):37557-69.
REF 8 MicroRNA-744 promotes prostate cancer progression through aberrantly activating Wnt/-catenin signaling. Oncotarget. 2017 Feb 28;8(9):14693-14707.
REF 9 miR-942 promotes cancer stem cell-like traits in esophageal squamous cell carcinoma through activation of Wnt/-catenin signalling pathway. Oncotarget. 2015 May 10;6(13):10964-77.
REF 10 Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the -Catenin/TCF/LEF-1 pathway in gastric cancer cells. Nucleic Acids Res. 2014 Mar;42(5):2988-98.
REF 11 MicroRNA-26a regulates insulin sensitivity and metabolism of glucose and lipids. J Clin Invest. 2015 Jun;125(6):2497-509.
REF 12 Transcriptional suppression of microRNA-27a contributes to laryngeal cancer differentiation via GSK-3-involved Wnt/-catenin pathway. Oncotarget. 2017 Feb 28;8(9):14708-14718.
REF 13 Octamer 4/microRNA-1246 signaling axis drives Wnt/-catenin activation in liver cancer stem cells. Hepatology. 2016 Dec;64(6):2062-2076.
REF 14 The role of glycogen synthase kinase-3 (GSK-3) in endometrial carcinoma: A carcinogenesis, progression, prognosis, and target therapy marker. Oncotarget. 2016 May 10;7(19):27538-51.
REF 15 Upregulation of miR-501-5p activates the wnt/-catenin signaling pathway and enhances stem cell-like phenotype in gastric cancer. J Exp Clin Cancer Res. 2016 Nov 15;35(1):177.
REF 16 Sulforaphane suppresses EMT and metastasis in human lung cancer through miR-616-5p-mediated GSK3/-catenin signaling pathways. Acta Pharmacol Sin. 2017 Feb;38(2):241-251.
REF 17 MiR-769 promoted cell proliferation in human melanoma by suppressing GSK3B expression. Biomed Pharmacother. 2016 Aug;82:117-23.
REF 18 miRNA-99b-3p functions as a potential tumor suppressor by targeting glycogen synthase kinase-3 in oral squamous cell carcinoma Tca-8113 cells. Int J Oncol. 2015 Oct;47(4):1528-36.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.