miRNA General Information
miRNA Mature ID	hsa-miR-129-1-3p
miRNA Stemloop AC	MI0000252
miRNA Stemloop ID	hsa-mir-129-1
Sequence	aagcccuuaccccaaaaaguau
TTD Target(s) Regulated by This miRNA	Glycogen synthase kinase-3 beta (GSK-3B)	Clinical trial Target	Target Info	[1]
	Aurora kinase A (AURKA)	Clinical trial Target	Target Info	[2]
	Programmed cell death protein 2 (PD-2)	Clinical trial Target	Target Info	[3]
References
REF 1	The role of glycogen synthase kinase-3 (GSK-3) in endometrial carcinoma: A carcinogenesis, progression, prognosis, and target therapy marker. Oncotarget. 2016 May 10;7(19):27538-51.
REF 2	Methylation-associated silencing of microRNA-129-3p promotes epithelial-mesenchymal transition, invasion and metastasis of hepatocelluar cancer by targeting Aurora-A. Oncotarget. 2016 Nov 22;7(47):78009-78028.
REF 3	miR-129-1-3p promote BGC-823 cell proliferation by targeting PDCD2. Anat Rec (Hoboken). 2014 Dec;297(12):2273-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.