Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T69991 Target Info
Target Name Wee1-like protein kinase (WEE1)
Synonyms Wee1A kinase; WEE1hu
Target Type Clinical trial Target
Gene Name WEE1
Biochemical Class Kinase
UniProt ID
P30291
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism miR-195 is sufficient to directly regulate the WEE1 3'UTR. [3]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay; Western Blot [3]
2 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism miR-221 target gene WEE1 was individually validated as miR-221 target in SNU-398,HepG2,and HEK293 cell lines. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 Sequencing [2]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism WEE1 is a target of miR-424. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-381-3p miRNA Info
miRNA Mature AC
MIMAT0000736
Sequence uauacaagggcaagcucucugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
2 PAR-CLIP [9]
Representative Target(s) Regulated by This miRNA Calcium-dependent chloride channel anoctamin (ANO) Target Info
ANO1_HUMAN
Gap junction alpha-1 protein (GJA1) Target Info
CXA1_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism WEE1 is predominantly influenced by miR-27b in a sequence-specific manner following binding to sites nearby the start of the WEE1 3'UTR. [12]
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism WEE1 is a target of miR-503. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-524-5p miRNA Info
miRNA Mature AC
MIMAT0002849
Sequence cuacaaagggaagcacuuucuc
miRNA Species Homo sapiens
Regulation Mechanism miR-524-5p regulates WEE1. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dual specificity protein kinase TTK (MPS1) Target Info
TTK_HUMAN
References  Top
REF 1 The miR-15 family enhances the radiosensitivity of breast cancer cells by targeting G2 checkpoints. Radiat Res. 2015 Feb;183(2):196-207.
REF 2 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 3 microRNAs regulate human embryonic stem cell division. Cell Cycle. 2009 Nov 15;8(22):3729-41.
REF 4 Regulation of cell cycle checkpoint kinase WEE1 by miR-195 in malignant melanoma. Oncogene. 2013 Jun 27;32(26):3175-83.
REF 5 miR-221 affects multiple cancer pathways by modulating the level of hundreds messenger RNAs. Front Genet. 2013 Apr 25;4:64.
REF 6 Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 7 Simultaneously expressed miR-424 and miR-381 synergistically suppress the proliferation and survival of renal cancer cells---Cdc2 activity is up-regulated by targeting WEE1. Clinics (Sao Paulo). 2013 Jun;68(6):825-33.
REF 8 MicroRNA-497 increases apoptosis in MYCN amplified neuroblastoma cells by targeting the key cell cycle regulator WEE1. Mol Cancer. 2013 Mar 26;12:23.
REF 9 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
REF 10 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 11 Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 12 Prediction of Associations between microRNAs and Gene Expression in Glioma Biology. PLoS One. 2011 Feb 16;6(2):e14681.
REF 13 Comprehensive analysis of the functional microRNA-mRNA regulatory network identifies miRNA signatures associated with glioma malignant progression. Nucleic Acids Res. 2013 Dec;41(22):e203.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.