Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T82795 Target Info
Target Name Beta-catenin (CTNNB1)
Synonyms Wnt/beta-catenin signaling pathway; PRO2286; OK/SW-cl.35; Catenin beta-1; CTNNB
Target Type Successful Target
Gene Name CTNNB1
Biochemical Class Beta-catenin
UniProt ID
P35222
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism miR-200a directly targets beta-catenin mRNA and inhibits beta-catenin/Wnt signaling. [5]
Evidence Score (E-score) 5 +
1 Immunocytochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot; Flow [4]
5 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism CTNNB1 is a downstream target of miR-214. [8]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
3 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-885-5p miRNA Info
miRNA Mature AC
MIMAT0004947
Sequence uccauuacacuacccugccucu
miRNA Species Homo sapiens
Regulation Mechanism miR-885-5p suppresses the metastasis of HCC and inhibits Wnt/B-catenin signaling pathway by its CTNNB1 target. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [11]
2 Western Blot [12]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-370-3p miRNA Info
miRNA Mature AC
MIMAT0000722
Sequence gccugcugggguggaaccuggu
miRNA Species Homo sapiens
Regulation Mechanism miR-370-3p is a post-ranscriptional regulator of CTNNB1 via directly binding to its 3'UTR mRNA. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
miRNA Mature ID hsa-miR-150-3p miRNA Info
miRNA Mature AC
MIMAT0004610
Sequence cugguacaggccugggggacag
miRNA Species Homo sapiens
Regulation Mechanism miR-150-3p directly targeted the 3'UTR of CTNNB1 mRNA and in turn repressed its expression. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-200a-5p miRNA Info
miRNA Mature AC
MIMAT0001620
Sequence caucuuaccggacagugcugga
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-200a decreased CTNNB1 expression level. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-34c-3p miRNA Info
miRNA Mature AC
MIMAT0004677
Sequence aaucacuaaccacacggccagg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Eukaryotic initiation factor 4E (EIF4E) Target Info
IF4E_HUMAN
miRNA Mature ID hsa-miR-506-5p miRNA Info
miRNA Mature AC
MIMAT0022701
Sequence uauucaggaagguguuacuuaa
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [16]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Metastasis adhesion protein (MTDH) Target Info
LYRIC_HUMAN
miRNA Mature ID hsa-miR-3162-3p miRNA Info
miRNA Mature AC
MIMAT0019213
Sequence ucccuaccccuccacucccca
miRNA Species Homo sapiens
Regulation Mechanism CTNNB1 is a direct target of miR-3162-3p as the 3'-untranslated region of CTNNB1 mRNA possesses a specific miR-3162-3p pairing site. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
References  Top
REF 1 LncRNA-ATB/microRNA-200a/-catenin regulatory axis involved in the progression of HCV-related hepatic fibrosis. Gene. 2017 Jun 30;618:1-7.
REF 2 Paraquat inhibited differentiation in human neural progenitor cells (hNPCs) and down regulated miR-200a expression by targeting CTNNB1. Environ Toxicol Pharmacol. 2016 Mar;42:205-11.
REF 3 miR-200a-mediated downregulation of ZEB2 and CTNNB1 differentially inhibits nasopharyngeal carcinoma cell growth, migration and invasion. Biochem Biophys Res Commun. 2010 Jan 1;391(1):535-41.
REF 4 MicroRNA-200a suppresses the Wnt/-catenin signaling pathway by interacting with -catenin. Int J Oncol. 2012 Apr;40(4):1162-70.
REF 5 Downregulated microRNA-200a in meningiomas promotes tumor growth by reducing E-cadherin and activating the Wnt/beta-catenin signaling pathway. Mol Cell Biol. 2009 Nov;29(21):5923-40.
REF 6 MiR-214 inhibits cell growth in hepatocellular carcinoma through suppression of -catenin. Biochem Biophys Res Commun. 2012 Nov 30;428(4):525-31.
REF 7 Regulation of -catenin-mediated esophageal cancer growth and invasion by miR-214. Am J Transl Res. 2015 Nov 15;7(11):2316-25.
REF 8 MiR-214 targets -catenin pathway to suppress invasion, stem-like traits and recurrence of human hepatocellular carcinoma. PLoS One. 2012;7(9):e44206.
REF 9 MiRNA-34 intrinsically links p53 tumor suppressor and Wnt signaling. Cell Cycle. 2012 Apr 1;11(7):1273-81.
REF 10 miR-34 - a microRNA replacement therapy is headed to the clinic. Front Genet. 2012 Jul 2;3:120.
REF 11 miR-885-5p suppresses hepatocellular carcinoma metastasis and inhibits Wnt/-catenin signaling pathway. Oncotarget. 2016 Nov 15;7(46):75038-75051.
REF 12 Circulating microRNAs as Potential Diagnostic and Prognostic Biomarkers in Hepatocellular Carcinoma. Sci Rep. 2019 Jul 18;9(1):10464.
REF 13 MicroRNA-370-3p inhibits human glioma cell proliferation and induces cell cycle arrest by directly targeting -catenin. Brain Res. 2016 Aug 1;1644:53-61.
REF 14 TNF--induced NF-B activation upregulates microRNA-150-3p and inhibits osteogenesis of mesenchymal stem cells by targeting -catenin. Open Biol. 2016 Mar;6(3). pii: 150258.
REF 15 The lncRNA H19 Promotes Cell Proliferation by Competitively Binding to miR-200a and Derepressing -Catenin Expression in Colorectal Cancer. Biomed Res Int. 2017;2017:2767484.
REF 16 miR-506 enhances the sensitivity of human colorectal cancer cells to oxaliplatin by suppressing MDR1/P-gp expression. Cell Prolif. 2017 Jun;50(3).
REF 17 MiR-3162-3p Is a Novel MicroRNA That Exacerbates Asthma by Regulating -Catenin. PLoS One. 2016 Mar 9;11(3):e0149257.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.