miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-506-5p | ||||
| miRNA Stemloop AC | MI0003193 | ||||
| miRNA Stemloop ID | hsa-mir-506 | ||||
| Sequence | uauucaggaagguguuacuuaa | ||||
| TTD Target(s) Regulated by This miRNA | Beta-catenin (CTNNB1) | Successful Target | Target Info | [1] | |
| Metastasis adhesion protein (MTDH) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Ras GTPase-activating-like protein IQGAP1 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | miR-506 enhances the sensitivity of human colorectal cancer cells to oxaliplatin by suppressing MDR1/P-gp expression. Cell Prolif. 2017 Jun;50(3). | ||||
| REF 2 | Overexpression of miR-506 suppresses proliferation and promotes apoptosis of osteosarcoma cells by targeting astrocyte elevated gene-1. Oncol Lett. 2016 Sep;12(3):1840-1848. | ||||
| REF 3 | miR-506 regulates breast cancer cell metastasis by targeting IQGAP1.Int J Oncol. 2015 Nov;47(5):1963-70. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.