Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T30823 Target Info
Target Name M-phase inducer phosphatase 1 (MPIP1)
Synonyms Dual specificity phosphatase Cdc25A; Cdc25A phosphatase
Target Type Literature-reported Target
Gene Name CDC25A
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
P30304
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Microarray; Northern Blot; qRT-PCR [2]
3 Luciferase Reporter Assay; Western Blot [3]
4 Microarray; Northern Blot; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of let-7b-5p by mature miRNA precursor transfection resulted in the changed protein level of target CDC25A. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; qRT-PCR [5]
2 Luciferase Reporter Assay; Microarray; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism The luciferase activity of the reporter vector containing the CDC25A wild-type 30-UTR was significantly inhibited by co-transfection. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
2 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism miR-449a directly target and inhibit CDC25A protein expression. [10]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [9]
2 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-503-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CDC25A. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [11]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-125b-5p miRNA Info
miRNA Mature AC
MIMAT0000423
Sequence ucccugagacccuaacuuguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-125b-5p resulted in the decreased protein level of target CDC25A. [2]
Evidence Score (E-score) 1 +
1 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Regulation Mechanism miR-141-3p decreased CDC25A protein levels. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Immunoblot; Western Blot [12]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-26a-1-3p miRNA Info
miRNA Mature AC
MIMAT0004499
Sequence ccuauucuugguuacuugcacg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [15]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-365a-3p miRNA Info
miRNA Mature AC
MIMAT0000710
Sequence uaaugccccuaaaaauccuuau
miRNA Species Homo sapiens
Regulation Mechanism Activation of Akt suppresses the abundance of p53, leading to decreased transcription of miR-365, thus causing upregulation of cdc25A, which promotes gastric cell proliferation/PTEN-Akt-p53-miR-365-cyclin D1 axis serves as a new mechanism underlying gastric tumorigenesis, providing potential new therapeutic targets. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism CDC25A is a target of miR-424. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-449b-5p miRNA Info
miRNA Mature AC
MIMAT0003327
Sequence aggcaguguauuguuagcuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism CDC25A is a direct target of miR-497 in HCC cells. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
References  Top
REF 1 High levels of oncomiR-21 contribute to the senescence-induced growth arrest in normal human cells and its knock-down increases the replicative lifespan. Aging Cell. 2013 Jun;12(3):446-58.
REF 2 The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22.
REF 3 MicroRNA miR-21 attenuates human cytomegalovirus replication in neural cells by targeting Cdc25a. J Virol. 2015 Jan 15;89(2):1070-82.
REF 4 microRNA-21 negatively regulates Cdc25A and cell cycle progression in colon cancer cells. Cancer Res. 2009 Oct 15;69(20):8157-65.
REF 5 Regression of murine lung tumors by the let-7 microRNA. Oncogene. 2010 Mar 18;29(11):1580-7.
REF 6 MicroRNA let-7c Inhibits Cell Proliferation and Induces Cell Cycle Arrest by Targeting CDC25A in Human Hepatocellular Carcinoma. PLoS One. 2015 Apr 24;10(4):e0124266.
REF 7 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 8 The tumor-suppressive miR-497-195 cluster targets multiple cell-cycle regulators in hepatocellular carcinoma. PLoS One. 2013;8(3):e60155.
REF 9 Changes in microRNA and mRNA expression with differentiation of human bronchial epithelial cells. Am J Respir Cell Mol Biol. 2013 Sep;49(3):384-95.
REF 10 miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. Genes Dev. 2009 Oct 15;23(20):2388-93.
REF 11 Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 12 miR-141-3p inhibits human stromal (mesenchymal) stem cell proliferation and differentiation. Biochim Biophys Acta. 2014 Sep;1843(9):2114-21.
REF 13 MicroRNA15a modulates expression of the cell-cycle regulator Cdc25A and affects hepatic cystogenesis in a rat model of polycystic kidney disease. J Clin Invest. 2008 Nov;118(11):3714-24.
REF 14 The Antitumor Effect of Metformin Is Mediated by miR-26a in Breast Cancer. Int J Mol Sci. 2016 Aug 10;17(8). pii: E1298.
REF 15 Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8.
REF 16 Akt-p53-miR-365-cyclin D1/cdc25A axis contributes to gastric tumorigenesis induced by PTEN deficiency. Nat Commun. 2013;4:2544.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.