Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T19027 Target Info
Target Name G1/S-specific cyclin-E2 (CCNE2)
Synonyms G1/Sspecific cyclinE2
Target Type Literature-reported Target
Gene Name CCNE2
UniProt ID
O96020
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Human cyclin E2 is a posttranscriptional target of miR-200a. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism The CCNE2 expressions of MSCs transfected with negative microRNA control mimic (miR-NC) and miR-30a mimic (miR-30a) were analyzed by Q-PCR and western blot. [4]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR [3]
2 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-30b-5p miRNA Info
miRNA Mature AC
MIMAT0000420
Sequence uguaaacauccuacacucagcu
miRNA Species Homo sapiens
Regulation Mechanism CCNE2 is a direct target of miR-30b in breast cancer cells. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism CCNE2 has been experimentally validated as miR-34 targets by western blotting. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism Direct interaction of miR-449 with the target gene CCNE2 3'UTR was confirmed. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-144-5p miRNA Info
miRNA Mature AC
MIMAT0004600
Sequence ggauaucaucauauacuguaag
miRNA Species Homo sapiens
Regulation Mechanism CCNE2 is directly regulated by miR-144-5p and might be good prognostic markers for survival of BC patients. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
G1/S-specific cyclin-E2 (CCNE2) Target Info
CCNE2_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism Human cyclin E2 is a posttranscriptional target of miR-200c. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism Human cyclin E2 is a posttranscriptional target of miR-200b. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-26a-1-3p miRNA Info
miRNA Mature AC
MIMAT0004499
Sequence ccuauucuugguuacuugcacg
miRNA Species Homo sapiens
Regulation Mechanism CCNE2 is downregulated after miR-26a transfection. [13]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [13]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Regulation Mechanism CCNE is inhibited by miR-34 at the translational level. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism CCNE is inhibited by miR-34 at the translational level. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-449b-5p miRNA Info
miRNA Mature AC
MIMAT0003327
Sequence aggcaguguauuguuagcuggc
miRNA Species Homo sapiens
Regulation Mechanism Direct interaction of miR-449 with the target gene CCNE2 3'UTR was confirmed. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism CCNE2 is a target of miR-503. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-664b-5p miRNA Info
miRNA Mature AC
MIMAT0022271
Sequence ugggcuaagggagaugauugggua
miRNA Species Homo sapiens
Regulation Mechanism CCNE2 was identified as a novel functional target of miR-664b-5p, and CCNE2 knockdown revealed effects similar to those observed with miR-664b-5p overexpression. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E2 (CCNE2) Target Info
CCNE2_HUMAN
References  Top
REF 1 MicroRNA-200 is commonly repressed in conjunctival MALT lymphoma, and targets cyclin E2. Graefes Arch Clin Exp Ophthalmol. 2012 Apr;250(4):523-31.
REF 2 The regulatory function of miR-200c on inflammatory and cell-cycle associated genes in SK-LMS-1, a leiomyosarcoma cell line. Reprod Sci. 2015 May;22(5):563-71.
REF 3 miRNA-30a functions as a tumor suppressor by downregulating cyclin E2 expression in castration-resistant prostate cancer. Mol Med Rep. 2016 Sep;14(3):2077-84.
REF 4 MiR-30a attenuates immunosuppressive functions of IL-1-elicited mesenchymal stem cells via targeting TAB3. FEBS Lett. 2015 Dec 21;589(24 Pt B):3899-907.
REF 5 Trastuzumab produces therapeutic actions by upregulating miR-26a and miR-30b in breast cancer cells. PLoS One. 2012;7(2):e31422.
REF 6 The role of miR-26a and miR-30b in HER2+ breast cancer trastuzumab resistance and regulation of the CCNE2 gene. Sci Rep. 2017 Jan 25;7:41309.
REF 7 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 8 microRNAs join the p53 network--another piece in the tumour-suppression puzzle. Nat Rev Cancer. 2007 Nov;7(11):819-22.
REF 9 miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. Mol Cancer. 2011 Mar 18;10:29.
REF 10 microRNA-449a functions as a tumor suppressor in neuroblastoma through inducing cell differentiation and cell cycle arrest. RNA Biol. 2015;12(5):538-54.
REF 11 The cell growth suppressor, mir-126, targets IRS-1. Biochem Biophys Res Commun. 2008 Dec 5;377(1):136-40.
REF 12 Tumour-suppressive microRNA-144-5p directly targets CCNE1/2 as potential prognostic markers in bladder cancer. Br J Cancer. 2015 Jul 14;113(2):282-9.
REF 13 The Antitumor Effect of Metformin Is Mediated by miR-26a in Breast Cancer. Int J Mol Sci. 2016 Aug 10;17(8). pii: E1298.
REF 14 Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 15 PARP inhibitor increases chemosensitivity by upregulating miR-664b-5p in BRCA1-mutated triple-negative breast cancer. Sci Rep. 2017 Feb 8;7:42319.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.