Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T07394 Target Info
Target Name Notch-1 receptor (NOTCH1)
Synonyms hN1; Translocationassociated notch protein TAN1; Translocation-associated notch protein TAN-1; TAN1; Notch 1 intracellular domain; Notch 1; Neurogenic locus notch homolog protein 1; NICD
Target Type Clinical trial Target
Gene Name NOTCH1
Biochemical Class Notch protein
UniProt ID
P46531
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target NOTCH1. [3]
Evidence Score (E-score) 14 +
1 ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; Microarray [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
8 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
9 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
10 Luciferase Reporter Assay; Western Blot [10]
11 Microarray; Western Blot [11]
12 qRT-PCR; Western Blot [12]
13 qRT-PCR; Western Blot [13]
14 Western Blot [14]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [15]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [16]
3 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Regulation Mechanism miRNA-34b directly targets Notch1 during BMP2-induced C2C12 osteoblast differentiation. [20]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [18]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [19]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [20]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism Notch-1 is a downstream target of miR-144 miRNA. [21]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [21]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism Reexpression of miR-200b by transfection led to reduced expression of Notch-1, resulting in the inhibition of osteosarcoma cell proliferation, invasion and angiogenesis. [12]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [19]
2 qRT-PCR; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism NOTCH1's 3'UTR is a target of miR-200c. [19]
Evidence Score (E-score) 2 +
1 Immunofluorescence; Western Blot [23]
2 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Reporter Assay [4]
2 Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of these miRNAs reduced the luciferase activity of reporter genes containing the Notch1-3'UTR sequence. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [4]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [24]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [19]
2 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism MicroRNA-449a regulates YKL40 expression by targeting NOTCH1 for silencing. [26]
Evidence Score (E-score) 2 +
1 ChIP; Luciferase Reporter Assay [25]
2 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miRNA-10b is a target gene of NOTCH1 to regulate invasiveness of U87-2M1 glioma cells. [27]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [27]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Notch1 is identified as potential target genes of miR46a. [28]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Regulation Mechanism Notch1 is significantly reduced in the HUEVCs stably overexpressing miR-296. [29]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [29]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-30a-3p miRNA Info
miRNA Mature AC
MIMAT0000088
Sequence cuuucagucggauguuugcagc
miRNA Species Homo sapiens
Regulation Mechanism Functional binding sites for miR-30a are present in the 3 'UTRs of NOTCH1. [30]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [30]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
miRNA Mature ID hsa-miR-30b-5p miRNA Info
miRNA Mature AC
MIMAT0000420
Sequence uguaaacauccuacacucagcu
miRNA Species Homo sapiens
Regulation Mechanism These results demonstrate that Notch1 is a direct target of miR-30s. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-30d-5p miRNA Info
miRNA Mature AC
MIMAT0000245
Sequence uguaaacauccccgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism Notch1 is a direct target of miR-30s. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Autophagy-related 2B (ATG2B) Target Info
ATG2B_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-30e-5p miRNA Info
miRNA Mature AC
MIMAT0000692
Sequence uguaaacauccuugacuggaag
miRNA Species Homo sapiens
Regulation Mechanism The wild-type reporter, but not the mutant, yielded a higher luciferase activity in the miR-30 Sponge-transfected cells than in the Mock control cells, showing that Notch1 is a direct target of miR-30s. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [31]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-363-3p miRNA Info
miRNA Mature AC
MIMAT0000707
Sequence aauugcacgguauccaucugua
miRNA Species Homo sapiens
Regulation Mechanism Enforced expression of miR-363-3p inhibited cell growth and migration of gastric cancer cells and NOTCH1 is the targeted gene of miR-363-3p. [32]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [32]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-410-3p miRNA Info
miRNA Mature AC
MIMAT0002171
Sequence aauauaacacagauggccugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunofluorescence; Western Blot [33]
Representative Target(s) Regulated by This miRNA Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
G2/mitotic-specific cyclin B1 (CCNB1) Target Info
CCNB1_HUMAN
miRNA Mature ID hsa-miR-935 miRNA Info
miRNA Mature AC
MIMAT0004978
Sequence ccaguuaccgcuuccgcuaccgc
miRNA Species Homo sapiens
Regulation Mechanism miR-935 inhibits gastric carcinoma cell proliferation, migration and invasion by targeting Notch1. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA Notch-1 receptor (NOTCH1) Target Info
NOTC1_HUMAN
References  Top
REF 1 MicroRNA-34a regulates liver regeneration and the development of liver cancer in rats by targeting Notch signaling pathway. Oncotarget. 2017 Feb 21;8(8):13264-13276.
REF 2 MicroRNA-34a modulates chemosensitivity of breast cancer cells to adriamycin by targeting Notch1. Arch Med Res. 2012 Oct;43(7):514-21.
REF 3 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 4 Exploration of human miRNA target genes in neuronal differentiation. Nucleic Acids Symp Ser (Oxf). 2005;(49):341-2.
REF 5 miRNA-34a reduces neointima formation through inhibiting smooth muscle cell proliferation and migration. J Mol Cell Cardiol. 2015 Dec;89(Pt A):75-86.
REF 6 Inhibitory effects of microRNA-34a on cell migration and invasion of invasive urothelial bladder carcinoma by targeting Notch1. J Huazhong Univ Sci Technolog Med Sci. 2012 Jun;32(3):375-382.
REF 7 Hypoxia-induced down-regulation of microRNA-34a promotes EMT by targeting the Notch signaling pathway in tubular epithelial cells. PLoS One. 2012;7(2):e30771.
REF 8 MicroRNA-34a suppresses invasion through downregulation of Notch1 and Jagged1 in cervical carcinoma and choriocarcinoma cells. Carcinogenesis. 2010 Jun;31(6):1037-44.
REF 9 MicroRNA-34a inhibits glioblastoma growth by targeting multiple oncogenes. Cancer Res. 2009 Oct 1;69(19):7569-76.
REF 10 miR-34a inhibits pancreatic cancer progression through Snail1-mediated epithelial-mesenchymal transition and the Notch signaling pathway. Sci Rep. 2017 Feb 1;7:38232.
REF 11 Delta-tocotrienol suppresses Notch-1 pathway by upregulating miR-34a in nonsmall cell lung cancer cells. Int J Cancer. 2012 Dec 1;131(11):2668-77.
REF 12 Diallyl trisulfide inhibits proliferation, invasion and angiogenesis of osteosarcoma cells by switching on suppressor microRNAs and inactivating of Notch-1 signaling. Carcinogenesis. 2013 Jul;34(7):1601-10.
REF 13 Synthetic miR-34a mimics as a novel therapeutic agent for multiple myeloma: in vitro and in vivo evidence. Clin Cancer Res. 2012 Nov 15;18(22):6260-70.
REF 14 microRNA miR-34a regulates cytodifferentiation and targets multi-signaling pathways in human dental papilla cells. PLoS One. 2012;7(11):e50090.
REF 15 MiR-139-5p reverses CD44+/CD133+-associated multidrug resistance by downregulating NOTCH1 in colorectal carcinoma cells. Oncotarget. 2016 Nov 15;7(46):75118-75129.
REF 16 MiR-139-5p inhibits the biological function of breast cancer cells by targeting Notch1 and mediates chemosensitivity to docetaxel. Biochem Biophys Res Commun. 2015 Oct 2;465(4):702-13.
REF 17 microRNA-139-5p exerts tumor suppressor function by targeting NOTCH1 in colorectal cancer. Mol Cancer. 2014 May 26;13:124.
REF 18 miRNA-34c regulates Notch signaling during bone development. Hum Mol Genet. 2012 Jul 1;21(13):2991-3000.
REF 19 Integrative genetic, epigenetic and pathological analysis of paraganglioma reveals complex dysregulation of NOTCH signaling. Acta Neuropathol. 2013 Oct;126(4):575-94.
REF 20 Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres. BMC Cancer. 2008 Sep 21;8:266.
REF 21 DCAMKL-1 regulates epithelial-mesenchymal transition in human pancreatic cells through a miR-200a-dependent mechanism. Cancer Res. 2011 Mar 15;71(6):2328-38.
REF 22 Nanoparticle-based delivery of siDCAMKL-1 increases microRNA-144 and inhibits colorectal cancer tumor growth via a Notch-1 dependent mechanism. J Nanobiotechnology. 2011 Sep 19;9:40.
REF 23 Garcinol downregulates Notch1 signaling via modulating miR-200c and suppresses oncogenic properties of PANC-1 cancer stem-like cells. Biotechnol Appl Biochem. 2017 Mar;64(2):165-173.
REF 24 Downregulation of microRNA-30 facilitates podocyte injury and is prevented by glucocorticoids. J Am Soc Nephrol. 2014 Jan;25(1):92-104.
REF 25 EVI1-mediated down regulation of MIR449A is essential for the survival of EVI1 positive leukaemic cells. Br J Haematol. 2011 Aug;154(3):337-48.
REF 26 Hepatitis C virus mediated changes in miRNA-449a modulates inflammatory biomarker YKL40 through components of the NOTCH signaling pathway. PLoS One. 2012;7(11):e50826.
REF 27 MicroRNA-10b pleiotropically regulates invasion, angiogenicity and apoptosis of tumor cells resembling mesenchymal subtype of glioblastoma multiforme. Cell Death Dis. 2012 Oct 4;3:e398.
REF 28 A functional polymorphism in the preiR 46a gene influences the prognosis of glioblastoma multiforme by interfering with the balance between Notch1 and Notch2. Mol Med Rep. 2015 Oct;12(4):5475-81.
REF 29 Prongiogenic microRNA 96 upregulatesvascular endothelial growth factor and downregulates Notch1 following cerebral ischemic injury. Mol Med Rep. 2015 Dec;12(6):8141-7.
REF 30 A microRNA-mediated regulatory loop modulates NOTCH and MYC oncogenic signals in B- and T-cell malignancies. Leukemia. 2015 Apr;29(4):968-76.
REF 31 The neuronal microRNA miR-326 acts in a feedback loop with notch and has therapeutic potential against brain tumors. J Neurosci. 2009 Dec 2;29(48):15161-8.
REF 32 Tumor Suppressor Role of miR-363-3p in Gastric Cancer. Med Sci Monit. 2015 Dec 28;21:4074-80.
REF 33 Tangeretin enhances radiosensitivity and inhibits the radiation-induced epithelial-mesenchymal transition of gastric cancer cells. Oncol Rep. 2015 Jul;34(1):302-10.
REF 34 miR-935 suppresses gastric signet ring cell carcinoma tumorigenesis by targeting Notch1 expression. Biochem Biophys Res Commun. 2016 Jan 29;470(1):68-74.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.