Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T85799 Target Info
Target Name Cyclin-dependent kinase 4 (CDK4)
Synonyms PSK-J3; Cell division protein kinase 4
Target Type Successful Target
Gene Name CDK4
Biochemical Class Kinase
UniProt ID
P11802
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism CDK4 has been experimentally validated as miR-34 targets by western blotting. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
3 Western Blot [3]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism CDK4 is a novel direct target of miR-195. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [4]
2 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism CDK4 is inhibited by miR-34 at the translational level. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Microarray; Western Blot; RT-PCR [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-506-3p miRNA Info
miRNA Mature AC
MIMAT0002878
Sequence uaaggcacccuucugaguaga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [7]
2 PAR-CLIP [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-545-3p miRNA Info
miRNA Mature AC
MIMAT0003165
Sequence ucagcaaacauuuauugugugc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
2 PAR-CLIP [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
LDL receptor related protein-1 (LRP-1) Target Info
LRP1_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 downregulated c-Myc and the c-Myc target gene CDK4. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism miR-206 inhibited protein translation of cyclins and CDK proteins in melanoma cell lines. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-24-3p miRNA Info
miRNA Mature AC
MIMAT0000080
Sequence uggcucaguucagcaggaacag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Enforced miR-29a-3p expression inhibited cell proliferation by reducing the expression of CDK4. [13]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [13]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Regulation Mechanism The transfection with pre-miR-302a into HeLa cells caused the Cdk4 protein levels to decrease demonstrating that Cdk4 is a target of miR-302 even in a heterologous system. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; RT-PCR [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Regulation Mechanism CDK4 is inhibited by miR-34 at the translational level. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [15]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-449b-5p miRNA Info
miRNA Mature AC
MIMAT0003327
Sequence aggcaguguauuguuagcuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [15]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism CDK4 is a target of miR-497 in HCC cells. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-483-3p miRNA Info
miRNA Mature AC
MIMAT0002173
Sequence ucacuccucuccucccgucuu
miRNA Species Homo sapiens
Regulation Mechanism CDK4 is a direct target of miR-483-3p. [16]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunofluorescence; Immunoprecipitation; Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-539-5p miRNA Info
miRNA Mature AC
MIMAT0003163
Sequence ggagaaauuauccuuggugugu
miRNA Species Homo sapiens
Regulation Mechanism The cyclin-dependent kinase 4 (CDK4) was verified as a miR-539 target gene using dual-luciferase reporter assays, quantitative RT-PCR and Western blotting. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Matrix metalloproteinase-8 (MMP-8) Target Info
MMP8_HUMAN
miRNA Mature ID hsa-miR-613 miRNA Info
miRNA Mature AC
MIMAT0003281
Sequence aggaauguuccuucuuugcc
miRNA Species Homo sapiens
Regulation Mechanism miR-613 suppresses CDK4 expression through the miR-613 binding sequence in its 3'UTR. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-711 miRNA Info
miRNA Mature AC
MIMAT0012734
Sequence gggacccagggagagacguaag
miRNA Species Homo sapiens
Regulation Mechanism RASSF1A inhibits the proliferation of gastric cancer cells by upregulating the expression of miR-711 which arrested gastric cancer cells in the G1 phase by downregulating expression of CDK4. [19]
Evidence Score (E-score) 1 +
1 Western Blot [19]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Transcription factor Sp1 (SP1) Target Info
SP1_HUMAN
References  Top
REF 1 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 2 microRNAs join the p53 network--another piece in the tumour-suppression puzzle. Nat Rev Cancer. 2007 Nov;7(11):819-22.
REF 3 Upregulation of p18Ink4c expression by oncogenic HPV E6 via p53-miR-34a pathway. Int J Cancer. 2011 Sep 15;129(6):1362-72.
REF 4 Cyclin-dependent kinase 4 is a novel target in micoRNA-195-mediated cell cycle arrest in bladder cancer cells. FEBS Lett. 2012 Feb 17;586(4):442-7.
REF 5 The tumor-suppressive miR-497-195 cluster targets multiple cell-cycle regulators in hepatocellular carcinoma. PLoS One. 2013;8(3):e60155.
REF 6 Methylation-associated silencing of microRNA-34b/c in gastric cancer and its involvement in an epigenetic field defect. Carcinogenesis. 2010 Dec;31(12):2066-73.
REF 7 MiR-506 suppresses proliferation and induces senescence by directly targeting the CDK4/6-FOXM1 axis in ovarian cancer. J Pathol. 2014 Jul;233(3):308-18.
REF 8 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 9 MicroRNA-545 suppresses cell proliferation by targeting cyclin D1 and CDK4 in lung cancer cells. PLoS One. 2014 Feb 5;9(2):e88022.
REF 10 Modulation of the unfolded protein response is the core of microRNA-122-involved sensitivity to chemotherapy in hepatocellular carcinoma. Neoplasia. 2011 Jul;13(7):590-600.
REF 11 miRNA-145 inhibits non-small cell lung cancer cell proliferation by targeting c-Myc. J Exp Clin Cancer Res. 2010 Nov 22;29:151.
REF 12 MicroRNA-206 induces G1 arrest in melanoma by inhibition of CDK4 and Cyclin D. Pigment Cell Melanoma Res. 2014 Mar;27(2):275-86.
REF 13 Reduced miR-29a-3p expression is linked to the cell proliferation and cell migration in gastric cancer. World J Surg Oncol. 2015 Mar 12;13:101.
REF 14 Oct4/Sox2-regulated miR-302 targets cyclin D1 in human embryonic stem cells. Mol Cell Biol. 2008 Oct;28(20):6426-38.
REF 15 miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. Genes Dev. 2009 Oct 15;23(20):2388-93.
REF 16 CDC25A targeting by miR-483-3p decreases CCND-CDK4/6 assembly and contributes to cell cycle arrest. Cell Death Differ. 2013 Jun;20(6):800-11.
REF 17 miR-539 induces cell cycle arrest in nasopharyngeal carcinoma by targeting cyclin-dependent kinase 4. Cell Biochem Funct. 2015 Dec;33(8):534-40.
REF 18 MiR-613 induces cell cycle arrest by targeting CDK4 in non-small cell lung cancer. Cell Oncol (Dordr). 2016 Apr;39(2):139-47.
REF 19 RASSF1A inhibits gastric cancer cell proliferation by miR-711- mediated downregulation of CDK4 expression. Oncotarget. 2016 Feb 2;7(5):5842-51.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.