Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T96736 Target Info
Target Name Transforming protein RhoA (RHOA)
Synonyms h12; Rho cDNA clone 12; RHO12; ARHA; ARH12
Target Type Discontinued Target
Gene Name RHOA
Biochemical Class Small GTPase
UniProt ID
P61586
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-31-5p resulted in the decreased protein level of target RHOA. [5]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 qRT-PCR; Western Blot [3]
4 qRT-PCR; Western Blot [4]
5 qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism Gene reporter experiments suggested a direct functional interaction between miR-122 and RHOA 3'UTR. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay; [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-125a-3p miRNA Info
miRNA Mature AC
MIMAT0004602
Sequence acaggugagguucuugggagcc
miRNA Species Homo sapiens
Regulation Mechanism RHOA is a miR-125a-3p target gene. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [8]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
Fyn tyrosine protein kinase (FYN) Target Info
FYN_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Regulation Mechanism miR-185 significantly suppressed the RhoA and Cdc42 3'UTR. [10]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [10]
2 qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-133a-3p miRNA Info
miRNA Mature AC
MIMAT0000427
Sequence uuugguccccuucaaccagcug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-133a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target RHOA. [5]
Evidence Score (E-score) 1 +
1 Western Blot [5]
Representative Target(s) Regulated by This miRNA Caspase-9 (CASP9) Target Info
CASP9_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133b targets RHOA to activate AKT1 and ERK. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism RHOA is a miR-146a target gene. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauaggggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-155-5p by mature miRNA precursor transfection resulted in the decreased protein level of target RHOA. [5]
Evidence Score (E-score) 1 +
1 Immunoblot; qRT-PCR; Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism RHOA is a miR-200b target gene. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism RhoA is a target of miR-200c. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism RHOA is directly target by miR-340. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-490-3p miRNA Info
miRNA Mature AC
MIMAT0002806
Sequence caaccuggaggacuccaugcug
miRNA Species Homo sapiens
Regulation Mechanism RHOA is a target of miR-490-3p. [17]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-200b-5p miRNA Info
miRNA Mature AC
MIMAT0004571
Sequence caucuuacugggcagcauugga
miRNA Species Homo sapiens
Regulation Mechanism miR-200b subfamily negatively regulated RHOA. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Prominin-1 (PROM1) Target Info
PROM1_HUMAN
Transforming protein RhoA (RHOA) Target Info
RHOA_HUMAN
miRNA Mature ID hsa-miR-31-3p miRNA Info
miRNA Mature AC
MIMAT0004504
Sequence ugcuaugccaacauauugccau
miRNA Species Homo sapiens
Regulation Mechanism miR-31 was found to target RhoA and to be able to inhibit the growth and migration of OSCC cells. [3]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Nectin cell adhesion molecule 4 (NECTIN4) Target Info
NECT4_HUMAN
Transcription factor E2F2 (E2F2) Target Info
E2F2_HUMAN
miRNA Mature ID hsa-miR-483-5p miRNA Info
miRNA Mature AC
MIMAT0004761
Sequence aagacgggaggaaagaagggag
miRNA Species Homo sapiens
Regulation Mechanism RHOA is a target of miR-483-5p. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Extracellular signal-regulated kinase 1 (ERK1) Target Info
MK03_HUMAN
References  Top
REF 1 MiR-31 Regulates Rho-Associated Kinase-Myosin Light Chain (ROCK-MLC) Pathway and Inhibits Gastric Cancer Invasion: Roles of RhoA. Med Sci Monit. 2016 Dec 1;22:4679-4691.
REF 2 A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell. 2009 Jun 12;137(6):1032-46.
REF 3 Passenger strand miRNA miR-31* regulates the phenotypes of oral cancer cells by targeting RhoA. Oral Oncol. 2013 Jan;49(1):27-33.
REF 4 Identification of microRNA-31 as a novel regulator contributing to impaired interleukin-2 production in T cells from patients with systemic lupus erythematosus. Arthritis Rheum. 2012 Nov;64(11):3715-25.
REF 5 MicroRNA-155 is regulated by the transforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol Cell Biol. 2008 Nov;28(22):6773-84.
REF 6 Loss of miR-122 expression in liver cancer correlates with suppression of the hepatic phenotype and gain of metastatic properties. Oncogene. 2009 Oct 8;28(40):3526-36.
REF 7 The microRNA network and tumor metastasis. Oncogene. 2010 Feb 18;29(7):937-48.
REF 8 MiRNA-125a-3p is a negative regulator of the RhoA-actomyosin pathway in A549 cells. Int J Oncol. 2013 May;42(5):1734-42.
REF 9 miR-125a-3p and miR-483-5p promote adipogenesis via suppressing the RhoA/ROCK1/ERK1/2 pathway in multiple symmetric lipomatosis. Sci Rep. 2015 Jul 7;5:11909.
REF 10 miR-185 targets RhoA and Cdc42 expression and inhibits the proliferation potential of human colorectal cells. Cancer Lett. 2011 Feb 28;301(2):151-60.
REF 11 Gastrokine 1 inhibits gastric cancer cell migration and invasion by downregulating RhoA expression. Gastric Cancer. 2017 Mar;20(2):274-285.
REF 12 MicroRNA-133b is a key promoter of cervical carcinoma development through the activation of the ERK and AKT1 pathways. Oncogene. 2012 Sep 6;31(36):4067-75.
REF 13 MicroRNA-146a inhibits cell migration and invasion by targeting RhoA in breast cancer. Oncol Rep. 2016 Jul;36(1):189-96.
REF 14 MiRNA-200b Regulates RMP7-Induced Increases in Blood-Tumor Barrier Permeability by Targeting RhoA and ROCKII. Front Mol Neurosci. 2016 Feb 5;9:9.
REF 15 Regulation of trabecular meshwork cell contraction and intraocular pressure by miR-200c. PLoS One. 2012;7(12):e51688.
REF 16 MicroRNA 340 is involved in UVB-induced dendrite formation through the regulation of RhoA expression in melanocytes. Mol Cell Biol. 2014 Sep 15;34(18):3407-20.
REF 17 MicroRNA-490 inhibits tumorigenesis and progression in breast cancer. Onco Targets Ther. 2016 Jul 22;9:4505-16.
REF 18 MiR-200b/200c/429 subfamily negatively regulates Rho/ROCK signaling pathway to suppress hepatocellular carcinoma metastasis. Oncotarget. 2015 May 30;6(15):13658-70.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.