miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-125a-3p | ||||
| miRNA Stemloop AC | MI0000469 | ||||
| miRNA Stemloop ID | hsa-mir-125a | ||||
| Sequence | acaggugagguucuugggagcc | ||||
| TTD Target(s) Regulated by This miRNA | Fyn tyrosine protein kinase (FYN) | Successful Target | Target Info | [1] | |
| Interleukin-6 (IL6) | Successful Target | Target Info | [2] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [3] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [4] | ||
| Interleukin 23 receptor (IL23R) | Clinical trial Target | Target Info | [5] | ||
| Pro-neuregulin-1 (Pro-NRG1) | Clinical trial Target | Target Info | [6] | ||
| Transforming protein RhoA (RHOA) | Discontinued Target | Target Info | [7] | ||
| Metastasis associated gene-1 (MTA1) | Literature-reported Target | Target Info | [8] | ||
| Protein(s) Regulated by This miRNA | ARF GTPase-activating protein GIT1 | Regulated Protein | [9] | ||
| Breast cancer type 1 susceptibility protein | Regulated Protein | [10] | |||
| Glypican-4 | Regulated Protein | [11] | |||
| Interferon regulatory factor 4 | Regulated Protein | [4] | |||
| PR domain zinc finger protein 1 | Regulated Protein | [4] | |||
| X-box-binding protein 1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | microRNA-125a-3p reduces cell proliferation and migration by targeting Fyn. J Cell Sci. 2013 Jul 1;126(Pt 13):2867-76. | ||||
| REF 2 | Rs12976445 Polymorphism is Associated with Risk of Diabetic Nephropathy Through Modulating Expression of MicroRNA-125 and Interleukin-6R. Med Sci Monit. 2015 Nov 13;21:3490-7. | ||||
| REF 3 | miR-125a regulates angiogenesis of gastric cancer by targeting vascular endothelial growth factor A. Int J Oncol. 2015 Nov;47(5):1801-10. | ||||
| REF 4 | EZH2 inhibition in multiple myeloma downregulates myeloma associated oncogenes and upregulates microRNAs with potential tumor suppressor functions. Oncotarget. 2017 Feb 7;8(6):10213-10224. | ||||
| REF 5 | Decreased expression of microRNA-125a-3p upregulates interleukin-23 receptor in patients with Hashimoto's thyroiditis. Immunol Res. 2015 Jun;62(2):129-36. | ||||
| REF 6 | MiR-125a-3p regulates glioma apoptosis and invasion by regulating Nrg1. PLoS One. 2015 Jan 5;10(1):e0116759. | ||||
| REF 7 | MiRNA-125a-3p is a negative regulator of the RhoA-actomyosin pathway in A549 cells. Int J Oncol. 2013 May;42(5):1734-42. | ||||
| REF 8 | miR-125a-3p targets MTA1 to suppress NSCLC cell proliferation, migration, and invasion. Acta Biochim Biophys Sin (Shanghai). 2015 Jul;47(7):496-503. | ||||
| REF 9 | miR-125a-3p targetedly regulates GIT1 expression to inhibit osteoblastic proliferation and differentiation.Exp Ther Med. 2016 Dec;12(6):4099-4106. | ||||
| REF 10 | Enforced expression of hsa-miR-125a-3p in breast cancer cells potentiates docetaxel sensitivity via modulation of BRCA1 signaling.Biochem Biophys Res Commun. 2016 Oct 28;479(4):893-900. | ||||
| REF 11 | MicroRNA-125a inhibits cell growth by targeting glypican-4.Glycoconj J. 2012 Oct;29(7):503-11. | ||||
| REF 12 | EZH2 inhibition in multiple myeloma downregulates myeloma associated oncogenes and upregulates microRNAs with potential tumor suppressor functions. Oncotarget. 2017 Feb 7;8(6):10213-10224. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.