miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-31-5p
miRNA Stemloop AC MI0000089
miRNA Stemloop ID hsa-mir-31
Sequence aggcaagaugcuggcauagcu
TTD Target(s) Regulated by This miRNA Proto-oncogene c-Ret (RET) Successful Target Target Info [1]
Proto-oncogene c-Src (SRC) Successful Target Target Info [2]
Protein kinase C epsilon (PRKCE) Successful Target Target Info [3]
Proto-oncogene c-Met (MET) Successful Target Target Info [2]
Extracellular calcium-sensing receptor (CASR) Successful Target Target Info [4]
Thromboxane A2 receptor (TBXA2R) Successful Target Target Info [5]
Intercellular adhesion molecule ICAM-1 (ICAM1) Successful Target Target Info [6]
Cyclin-dependent kinase 1 (CDK1) Clinical trial Target Target Info [7]
Integrin alpha-5 (ITGA5) Clinical trial Target Target Info [8]
Dickkopf-related protein 1 (DKK1) Clinical trial Target Target Info [9]
Dystrophin (DMD) Clinical trial Target Target Info [10]
E-selectin (SELE) Clinical trial Target Target Info [6]
Stromal cell-derived factor 1 (CXCL12) Clinical trial Target Target Info [1]
Interleukin-25 (IL25) Clinical trial Target Target Info [11]
Transforming protein RhoA (RHOA) Discontinued Target Target Info [12]
Large tumor suppressor homolog 2 (LATS2) Literature-reported Target Target Info [13]
MEK kinase kinase 4 (MAP4K4) Patented-recorded Target Target Info [2]
Matrix metalloproteinase-16 (MMP-16) Literature-reported Target Target Info [14]
X-ray repair cross-complementing 5 (Ku80) Literature-reported Target Target Info [15]
Excitatory amino acid transporter 2 (SLC1A2) Literature-reported Target Target Info [16]
Protein C-ets-1 (ETS1) Literature-reported Target Target Info [1]
DNA mismatch repair protein Mlh1 (MLH1) Literature-reported Target Target Info [17]
GTPase activating protein (RASA1) Literature-reported Target Target Info [18]
T-lymphoma invasion and metastasis 1 (TIAM1) Literature-reported Target Target Info [19]
Transcription factor E2F2 (E2F2) Literature-reported Target Target Info [20]
Stathmin-1 (STMN1) Literature-reported Target Target Info [21]
Protein(s) Regulated by This miRNA Actin-related protein 2/3 complex subunit 5 Regulated Protein
ARPC5_HUMAN
[1]
AF4/FMR2 family member 1 Regulated Protein
AFF1_HUMAN
[23]
AT-rich interactive domain-containing protein 1A Regulated Protein
ARI1A_HUMAN
[24]
ATP-binding cassette sub-family B member 9 Regulated Protein
ABCB9_HUMAN
[25]
BRCA2-interacting transcriptional repressor EMSY Regulated Protein
EMSY_HUMAN
[26]
Complement C1q and tumor necrosis factor-related protein 9A Regulated Protein
C1T9A_HUMAN
[27]
Dapper homolog 3 Regulated Protein
DACT3_HUMAN
[9]
Dedicator of cytokinesis protein 1 Regulated Protein
DOCK1_HUMAN
[29]
DNA replication licensing factor MCM2 Regulated Protein
MCM2_HUMAN
[7]
DNA-binding protein SATB2 Regulated Protein
SATB2_HUMAN
[31]
Forkhead box protein O3 Regulated Protein
FOXO3_HUMAN
[32]
Forkhead box protein P3 Regulated Protein
FOXP3_HUMAN
[33]
Frizzled-3 Regulated Protein
FZD3_HUMAN
[1]
Guanine nucleotide-binding protein subunit alpha-13 Regulated Protein
GNA13_HUMAN
[34]
Homeobox protein Hox-C13 Regulated Protein
HXC13_HUMAN
[1]
Hypoxia-inducible factor 1-alpha inhibitor Regulated Protein
HIF1N_HUMAN
[35]
Juxtaposed with another zinc finger protein 1 Regulated Protein
JAZF1_HUMAN
[1]
Krueppel-like factor 13 Regulated Protein
KLF13_HUMAN
[1]
Mothers against decapentaplegic homolog 4 Regulated Protein
SMAD4_HUMAN
[36]
Myosin phosphatase Rho-interacting protein Regulated Protein
MPRIP_HUMAN
[1]
Nuclear factor of activated T-cells 5 Regulated Protein
NFAT5_HUMAN
[1]
Protein CREG1 Regulated Protein
CREG1_HUMAN
[37]
Protein numb homolog Regulated Protein
NUMB_HUMAN
[1]
Protein sprouty homolog 1 Regulated Protein
SPY1_HUMAN
[38]
Protein sprouty homolog 3 Regulated Protein
SPY3_HUMAN
[38]
Protein sprouty homolog 4 Regulated Protein
SPY4_HUMAN
[38]
Radixin Regulated Protein
RADI_HUMAN
[1]
Radixin Regulated Protein
RADI_HUMAN
[39]
Ras-related protein Rab-27A Regulated Protein
RB27A_HUMAN
[2]
Rho-related BTB domain-containing protein 1 Regulated Protein
RHBT1_HUMAN
[41]
Serine/threonine-protein kinase 40 Regulated Protein
STK40_HUMAN
[42]
Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform Regulated Protein
2ABA_HUMAN
[43]
Sphingosine-1-phosphate phosphatase 2 Regulated Protein
SGPP2_HUMAN
[36]
Sprouty-related, EVH1 domain-containing protein 1 Regulated Protein
SPRE1_HUMAN
[38]
Sprouty-related, EVH1 domain-containing protein 2 Regulated Protein
SPRE2_HUMAN
[38]
Transcription factor SOX-4 Regulated Protein
SOX4_HUMAN
[44]
Transcription factor Sp7 Regulated Protein
SP7_HUMAN
[45]
Transcriptional repressor protein YY1 Regulated Protein
TYY1_HUMAN
[1]
Ubiquitin carboxyl-terminal hydrolase BAP1 Regulated Protein
BAP1_HUMAN
[46]
Wiskott-Aldrich syndrome protein family member 3 Regulated Protein
WASF3_HUMAN
[47]
References
REF 1 A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell. 2009 Jun 12;137(6):1032-46.
REF 2 Genetic and epigenetic loss of microRNA-31 leads to feed-forward expression of EZH2 in melanoma. Oncotarget. 2012 Sep;3(9):1011-25.
REF 3 MicroRNA-31 sensitizes human breast cells to apoptosis by direct targeting of protein kinase C epsilon (PKCepsilon). J Biol Chem. 2013 Mar 22;288(12):8750-61.
REF 4 miR-31 ablates expression of the HIF regulatory factor FIH to activate the HIF pathway in head and neck carcinoma. Cancer Res. 2010 Feb 15;70(4):1635-44.
REF 5 Deficiency of the microRNA-31-microRNA-720 pathway in the plasma and endothelial progenitor cells from patients with coronary artery disease. Arterioscler Thromb Vasc Biol. 2014 Apr;34(4):857-69.
REF 6 Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5.
REF 7 Epigenetic repression of miR-31 disrupts androgen receptor homeostasis and contributes to prostate cancer progression. Cancer Res. 2013 Feb 1;73(3):1232-44.
REF 8 MicroRNA-92a controls angiogenesis and functional recovery of ischemic tissues in mice. Science. 2009 Jun 26;324(5935):1710-3.
REF 9 Cigarette smoke induces C/EBP--mediated activation of miR-31 in normal human respiratory epithelia and lung cancer cells. PLoS One. 2010 Oct 29;5(10):e13764.
REF 10 miR-31 modulates dystrophin expression: new implications for Duchenne muscular dystrophy therapy. EMBO Rep. 2011 Feb;12(2):136-41.
REF 11 The signaling axis of microRNA-31/interleukin-25 regulates Th1/Th17-mediated inflammation response in colitis. Mucosal Immunol. 2017 Jul;10(4):983-995.
REF 12 MicroRNA-155 is regulated by the transforming growth factor beta/Smad pathway and contributes to epithelial cell plasticity by targeting RhoA. Mol Cell Biol. 2008 Nov;28(22):6773-84.
REF 13 A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell. 2006 Mar 24;124(6):1169-81.
REF 14 microRNA-146b inhibits glioma cell migration and invasion by targeting MMPs. Brain Res. 2009 May 7;1269:158-65.
REF 15 K14-EGFP-miR-31 transgenic mice have high susceptibility to chemical-induced squamous cell tumorigenesis that is associating with Ku80 repression. Int J Cancer. 2015 Mar 15;136(6):1263-75.
REF 16 Identification of miR-31-5p, miR-141-3p, miR-200c-3p, and GLT1 as human liver aging markers sensitive to donor-recipient age-mismatch in transplants. Aging Cell. 2017 Apr;16(2):262-272.
REF 17 MicroRNA-31-5p modulates cell cycle by targeting human mutL homolog 1 in human cancer cells. Tumour Biol. 2013 Jun;34(3):1959-65.
REF 18 MicroRNA-31 activates the RAS pathway and functions as an oncogenic MicroRNA in human colorectal cancer by repressing RAS p21 GTPase activating protein 1 (RASA1). J Biol Chem. 2013 Mar 29;288(13):9508-18.
REF 19 miR-21 and miR-31 converge on TIAM1 to regulate migration and invasion of colon carcinoma cells. J Biol Chem. 2010 Nov 12;285(46):35293-302.
REF 20 Downregulated miR-31 level associates with poor prognosis of gastric cancer and its restoration suppresses tumor cell malignant phenotypes by inhibiting E2F2. Oncotarget. 2016 Jun 14;7(24):36577-36589.
REF 21 P18/Stathmin1 is regulated by miR-31 in ovarian cancer in response to taxane. Oncoscience. 2015 Mar 23;2(3):294-308.
REF 22 A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell. 2009 Jun 12;137(6):1032-46.
REF 23 MicroRNA-200c and microRNA-31 regulate proliferation, colony formation, migration and invasion in serous ovarian cancer.J Ovarian Res. 2015 Aug 12;8:56.
REF 24 MiR-31 is an independent prognostic factor and functions as an oncomir in cervical cancer via targeting ARID1A.Gynecol Oncol. 2014 Jul;134(1):129-37.
REF 25 MicroRNA-31 inhibits cisplatin-induced apoptosis in non-small cell lung cancer cells by regulating the drug transporter ABCB9.Cancer Lett. 2014 Feb 28;343(2):249-57.
REF 26 The breast cancer oncogene EMSY represses transcription of antimetastatic microRNA miR-31.Mol Cell. 2014 Mar 6;53(5):806-18.
REF 27 miR-31 Links Lipid Metabolism and Cell Apoptosis in Bacteria-Challenged Apostichopus japonicus via Targeting CTRP9.Front Immunol. 2017 Mar 13;8:263.
REF 28 Cigarette smoke induces C/EBP--mediated activation of miR-31 in normal human respiratory epithelia and lung cancer cells. PLoS One. 2010 Oct 29;5(10):e13764.
REF 29 Dock1 promotes the mesenchymal transition of glioma and is modulated by MiR-31.Neuropathol Appl Neurobiol. 2017 Aug;43(5):419-432.
REF 30 Epigenetic repression of miR-31 disrupts androgen receptor homeostasis and contributes to prostate cancer progression. Cancer Res. 2013 Feb 1;73(3):1232-44.
REF 31 The role of miR-31 and its target gene SATB2 in cancer-associated fibroblasts.Cell Cycle. 2010 Nov 1;9(21):4387-98.
REF 32 Reprogramming of Normal Fibroblasts into Cancer-Associated Fibroblasts by miRNAs-Mediated CCL2/VEGFA Signaling. PLoS Genet. 2016 Aug 19;12(8):e1006244.
REF 33 Human natural Treg microRNA signature: role of microRNA-31 and microRNA-21 in FOXP3 expression.Eur J Immunol. 2009 Jun;39(6):1608-18.
REF 34 MicroRNA-31 controls G protein alpha-13 (GNA13) expression and cell invasion in breast cancer cells.Mol Cancer. 2015 Mar 26;14:67.
REF 35 MicroRNA-31 targets FIH-1 to positively regulate corneal epithelial glycogen metabolism.FASEB J. 2012 Aug;26(8):3140-7.
REF 36 Tumor suppressor microRNA-31 inhibits gastric carcinogenesis by targeting Smad4 and SGPP2.Cancer Gene Ther. 2015 Dec;22(12):564-72.
REF 37 MicroRNA-31 controls phenotypic modulation of human vascular smooth muscle cells by regulating its target gene cellular repressor of E1A-stimulated genes.Exp Cell Res. 2013 May 1;319(8):1165-75.
REF 38 MicroRNA-31 initiates lung tumorigenesis and promotes mutant KRAS-driven lung cancer. J Clin Invest. 2016 Jan;126(1):349-64.
REF 39 Human miR-31 targets radixin and inhibits migration and invasion of glioma cells.Oncol Rep. 2012 Mar;27(3):700-6.
REF 40 Genetic and epigenetic loss of microRNA-31 leads to feed-forward expression of EZH2 in melanoma. Oncotarget. 2012 Sep;3(9):1011-25.
REF 41 The tumor suppressor gene RhoBTB1 is a novel target of miR-31 in human colon cancer.Int J Oncol. 2013 Feb;42(2):676-82.
REF 42 MicroRNA-31 is overexpressed in psoriasis and modulates inflammatory cytokine and chemokine production in keratinocytes via targeting serine/threonine kinase 40.J Immunol. 2013 Jan 15;190(2):678-88.
REF 43 MicroRNA-31 functions as an oncogenic microRNA in mouse and human lung cancer cells by repressing specific tumor suppressors. J Clin Invest. 2010 Apr;120(4):1298-309.
REF 44 SOX4 interacts with EZH2 and HDAC3 to suppress microRNA-31 in invasive esophageal cancer cells.Mol Cancer. 2015 Feb 3;14:24.
REF 45 MicroRNA expression profiling of human bone marrow mesenchymal stem cells during osteogenic differentiation reveals Osterix regulation by miR-31.Gene. 2013 Sep 15;527(1):321-31.
REF 46 BAP1 suppresses lung cancer progression and is inhibited by miR-31.Oncotarget. 2016 Mar 22;7(12):13742-53.
REF 47 WAVE3, an actin remodeling protein, is regulated by the metastasis suppressor microRNA, miR-31, during the invasion-metastasis cascade.Int J Cancer. 2011 Sep 15;129(6):1331-43.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.