Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T94048 Target Info
Target Name Yes-associated protein 1 (YAP1)
Synonyms Yorkie homolog; Yes-associated protein YAP65 homolog; YAP65; Transcriptional coactivator YAP1; Protein yorkie homolog; 65 kDa Yes-associated protein
Target Type Literature-reported Target
Gene Name YAP1
UniProt ID
P46937
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism Targeting YAP1 by tumor suppressor miRNA miR-15a and miR-16-1 plays inhibitory effect and this might have a therapeutic potential in gastric adenocarcinoma. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism miR-195-5p binding sites are within the 3'untranslated region (3'UTR) of the human yes-associated protein (YAP) mRNA. YAP1 expression was downregulated after miR-195-5p treatment. [5]
Evidence Score (E-score) 2 +
1 Immunohistochemistry [5]
2 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-506-3p miRNA Info
miRNA Mature AC
MIMAT0002878
Sequence uaaggcacccuucugaguaga
miRNA Species Homo sapiens
Regulation Mechanism miR-506 specifically binds to the 3'UTR of YAP mRNA. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [6]
2 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [8]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism YAP1 (Yes-associated protein-1) was a direct target gene of miR- 27a-3p. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-630 miRNA Info
miRNA Mature AC
MIMAT0003299
Sequence aguauucuguaccagggaaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-375-3p miRNA Info
miRNA Mature AC
MIMAT0000728
Sequence uuuguucguucggcucgcguga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Janus kinase 2 (JAK-2) Target Info
JAK2_HUMAN
Yes-associated protein 1 (YAP1) Target Info
YAP1_HUMAN
miRNA Mature ID hsa-miR-424-3p miRNA Info
miRNA Mature AC
MIMAT0004749
Sequence caaaacgugaggcgcugcuau
miRNA Species Homo sapiens
Regulation Mechanism miR-424-3p suppress the level of YAP1 protein by targeting its 3 untranslated region, MiR-424-3p directly and negatively regulates YAP1. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Galectin-3 (LGALS3) Target Info
LEG3_HUMAN
Yes-associated protein 1 (YAP1) Target Info
YAP1_HUMAN
References  Top
REF 1 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
REF 2 Prognostic significance of microRNA-141 expression and its tumor suppressor function in human pancreatic ductal adenocarcinoma. Mol Cell Biochem. 2014 Mar;388(1-2):39-49.
REF 3 Targeting of YAP1 by microRNA-15a and microRNA-16-1 exerts tumor suppressor function in gastric adenocarcinoma. Mol Cancer. 2015 Feb 22;14:52.
REF 4 LncRNA PFAR contributes to fibrogenesis in lung fibroblasts through competitively binding to miR-15a. Biosci Rep. 2019 Jul 18;39(7). pii: BSR20190280.
REF 5 Integrated analysis identifies microRNA-195 as a suppressor of Hippo-YAP pathway in colorectal cancer. J Hematol Oncol. 2017 Mar 29;10(1):79.
REF 6 Up-regulation of miR-506 inhibits cell growth and disrupt the cell cycle by targeting YAP in breast cancer cells. Int J Clin Exp Med. 2015 Aug 15;8(8):12018-27.
REF 7 MicroRNA-506 inhibits gastric cancer proliferation and invasion by directly targeting Yap1. Tumour Biol. 2015 Sep;36(9):6823-31.
REF 8 MicroRNA-200a promotes anoikis resistance and metastasis by targeting YAP1 in human breast cancer. Clin Cancer Res. 2013 Mar 15;19(6):1389-99.
REF 9 MicroRNA-27a-3p regulates epithelial to mesenchymal transition via targeting YAP1 in oral squamous cell carcinoma cells. Oncol Rep. 2016 Sep;36(3):1475-82.
REF 10 Phospho-Np63 is a key regulator of the cisplatin-induced microRNAome in cancer cells. Cell Death Differ. 2011 Jul;18(7):1220-30.
REF 11 Experience of a rapid access blackout service for older people. Age Ageing. 2010 Mar;39(2):265-8.
REF 12 Loss of MiR-424-3p, not miR-424-5p, confers chemoresistance through targeting YAP1 in non-small cell lung cancer. Mol Carcinog. 2017 Mar;56(3):821-832.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.