Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T93122 Target Info
Target Name Brain-derived neurotrophic factor (BDNF)
Synonyms Brainderived neurotrophic factor; Abrineurin
Target Type Clinical trial Target
Gene Name BDNF
Biochemical Class Growth factor
UniProt ID
P23560
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10a-5p miRNA Info
miRNA Mature AC
MIMAT0000253
Sequence uacccuguagauccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism The opposite expression patterns for BDNF and the miR-10 family in GCs further indicated the repressive effect of miR-10a/b on BDNF. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Regulation Mechanism BDNF levels were decreased in miR-182-treated cells. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [3]
2 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism miR-204 targets BDNF/Ezrin by binding to the predicted site in its 3'UTR. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism BDNF was down-modulated following miR-210 overexpression and induced when miR-210 was inhibited. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-1-3p miRNA Info
miRNA Mature AC
MIMAT0000416
Sequence uggaauguaaagaaguauguau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-124-3p miRNA Info
miRNA Mature AC
MIMAT0000422
Sequence uaaggcacgcggugaaugcc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-124-3p resulted in the decreased protein level of target BDNF. [9]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [9]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism BDNF levels were decreased in miR-132-treated cells. [4]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism The anti-metastasis effect of miR-206 is mediated by targeting BDNF, which is drastically down-regulated by stable expression of exogenous miR-206 in SGC7901 cells. [11]
Evidence Score (E-score) 1 +
1 qRT-PCR [11]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism The regulator of BDNF was potentially repressed by miR-22. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism miR-30a-5p targets specific sequences surrounding the proximal polyadenylation site within BDNF 3-untranslated region. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-96-5p miRNA Info
miRNA Mature AC
MIMAT0000095
Sequence uuuggcacuagcacauuuuugcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA 5-HT 1B receptor (HTR1B) Target Info
5HT1B_HUMAN
ALK tyrosine kinase receptor (ALK) Target Info
ALK_HUMAN
miRNA Mature ID hsa-miR-613 miRNA Info
miRNA Mature AC
MIMAT0003281
Sequence aggaauguuccuucuuugcc
miRNA Species Homo sapiens
Regulation Mechanism miR-613 directly targets the 3'UTR of BDNF. This finding suggests that miR-613 negatively regulates the expression of BDNF in SH-SY5Y cells. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells. Sci Rep. 2017 Jan 23;7:41304.
REF 2 MicroRNA-10a-5p suppresses cancer proliferation and division in human cervical cancer by targeting BDNF. Exp Ther Med. 2017 Dec;14(6):6147-6151.
REF 3 Brain-derived neurotrophic factor is a novel target gene of the has-miR-183/96/182 cluster in retinal pigment epithelial cells following visible light exposure. Mol Med Rep. 2015 Aug;12(2):2793-9.
REF 4 Alterations of serum levels of BDNF-related miRNAs in patients with depression. PLoS One. 2013 May 21;8(5):e63648.
REF 5 Up-Regulation of miR-204 Enhances Anoikis Sensitivity in Epithelial Ovarian Cancer Cell Line Via Brain-Derived Neurotrophic Factor Pathway In Vitro. Int J Gynecol Cancer. 2015 Jul;25(6):944-52.
REF 6 Genomic loss of tumor suppressor miRNA-204 promotes cancer cell migration and invasion by activating AKT/mTOR/Rac1 signaling and actin reorganization. PLoS One. 2012;7(12):e52397.
REF 7 Downregulation of miR-210 protected bupivacaine-induced neurotoxicity in dorsal root ganglion. Exp Brain Res. 2016 Apr;234(4):1057-65.
REF 8 An integrated approach for experimental target identification of hypoxia-induced miR-210. J Biol Chem. 2009 Dec 11;284(50):35134-43.
REF 9 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 10 MicroRNA-15a-5p suppresses cancer proliferation and division in human hepatocellular carcinoma by targeting BDNF. Tumour Biol. 2016 May;37(5):5821-8.
REF 11 MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26.
REF 12 Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways. Biol Psychiatry. 2011 Mar 15;69(6):526-33.
REF 13 A set of differentially expressed miRNAs, including miR-30a-5p, act as post-transcriptional inhibitors of BDNF in prefrontal cortex. Hum Mol Genet. 2008 Oct 1;17(19):3030-42.
REF 14 MicroRNA-613 regulates the expression of brain-derived neurotrophic factor in Alzheimer's disease. Biosci Trends. 2016 Nov 15;10(5):372-377.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.