Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T88786 Target Info
Target Name N-myc proto-oncogene protein (MYCN)
Synonyms bHLHe37; NMYC; N-myc; Class E basic helix-loop-helix protein 37
Target Type Literature-reported Target
Gene Name MYCN
UniProt ID
P04198
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34a-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target MYCN. [5]
Evidence Score (E-score) 10 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Luciferase Reporter Assay; Western Blot [7]
8 Luciferase Reporter Assay; Western Blot [8]
9 qRT-PCR; Western Blot; Luciferase Reporter Assay [9]
10 Western Blot [10]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of let-7e was sufficient to reduce proliferation and downregulate MYCN. [12]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [11]
2 Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism The MYCN transcription factor is a direct target of miR-29a in neuroblastoma. [12]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [13]
2 Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-449a binds to the MYCN 3'UTR. [14]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [2]
2 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-101-3p miRNA Info
miRNA Mature AC
MIMAT0000099
Sequence uacaguacugugauaacugaa
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-202-3p miRNA Info
miRNA Mature AC
MIMAT0002811
Sequence agagguauagggcaugggaa
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [12]
Representative Target(s) Regulated by This miRNA B-cell-activating factor (TNFSF13B) Target Info
TN13B_HUMAN
LDL receptor related protein-6 (LRP-6) Target Info
LRP6_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Regulation Mechanism miR-34a-5p can target the 3'UTR of MYCN mRNA. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-449b-5p miRNA Info
miRNA Mature AC
MIMAT0003327
Sequence aggcaguguauuguuagcuggc
miRNA Species Homo sapiens
Regulation Mechanism miR-449b-5p can directly target the 3'UTR of MYCN mRNA. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
References  Top
REF 1 Inhibition of neuroblastoma tumor growth by targeted delivery of microRNA-34a using anti-disialoganglioside GD2 coated nanoparticles. PLoS One. 2012;7(5):e38129.
REF 2 A combined gene expression and functional study reveals the crosstalk between N-Myc and differentiation-inducing microRNAs in neuroblastoma cells. Oncotarget. 2016 Nov 29;7(48):79372-79387.
REF 3 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 4 MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells. Oncogene. 2007 Jul 26;26(34):5017-22.
REF 5 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 6 miR-34a sensitizes lung cancer cells to cisplatin via p53/miR-34a/MYCN axis. Biochem Biophys Res Commun. 2017 Jan 1;482(1):22-27.
REF 7 miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60.
REF 8 The MYCN oncogene is a direct target of miR-34a. Oncogene. 2008 Sep 4;27(39):5204-13.
REF 9 A functional screen identifies miR-34a as a candidate neuroblastoma tumor suppressor gene. Mol Cancer Res. 2008 May;6(5):735-42.
REF 10 MiR-34a deficiency accelerates medulloblastoma formation in vivo. Int J Cancer. 2015 May 15;136(10):2293-303.
REF 11 LIN28 Expression in malignant germ cell tumors downregulates let-7 and increases oncogene levels. Cancer Res. 2013 Aug 1;73(15):4872-84.
REF 12 Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br J Cancer. 2011 Jul 12;105(2):296-303.
REF 13 The microRNA body map: dissecting microRNA function through integrative genomics. Nucleic Acids Res. 2011 Nov 1;39(20):e136.
REF 14 MiR-449a Affects Epithelial Proliferation during the Pseudoglandular and Canalicular Phases of Avian and Mammal Lung Development. PLoS One. 2016 Feb 18;11(2):e0149425.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.