miRNA General Information
miRNA Mature ID	hsa-miR-101-3p
miRNA Stemloop AC	MI0000103 | MI0000739
miRNA Stemloop ID	hsa-mir-101-1 | hsa-mir-101-2
Sequence	uacaguacugugauaacugaa
TTD Target(s) Regulated by This miRNA	Prostaglandin G/H synthase 2 (COX-2)	Successful Target	Target Info	[1]
	ATM serine/threonine kinase (ATM)	Clinical trial Target	Target Info	[2]
	Enhancer of zeste homolog 2 (EZH2)	Successful Target	Target Info	[3]
	Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1)	Clinical trial Target	Target Info	[4]
	Inducible T-cell costimulator (ICOS)	Clinical trial Target	Target Info	[5]
	N-myc proto-oncogene protein (MYCN)	Literature-reported Target	Target Info	[6]
Protein(s) Regulated by This miRNA	5'-AMP-activated protein kinase subunit beta-1	Regulated Protein	AAKB1_HUMAN	[7]
	AT-rich interactive domain-containing protein 1A	Regulated Protein	ARI1A_HUMAN	[8]
	Ataxin-1	Regulated Protein	ATX1_HUMAN	[9]
	ATP synthase subunit beta, mitochondrial	Regulated Protein	ATPB_HUMAN	[10]
	Cysteine protease ATG4D	Regulated Protein	ATG4D_HUMAN	[11]
	Cytoplasmic polyadenylation element-binding protein 1	Regulated Protein	CPEB1_HUMAN	[12]
	Eyes absent homolog 1	Regulated Protein	EYA1_HUMAN	[13]
	Fibrillin-2	Regulated Protein	FBN2_HUMAN	[8]
	G-rich sequence factor 1	Regulated Protein	GRSF1_HUMAN	[14]
	Homeobox protein Meis1	Regulated Protein	MEIS1_HUMAN	[15]
	Integrin alpha-3	Regulated Protein	ITA3_HUMAN	[16]
	Krueppel-like factor 6	Regulated Protein	KLF6_HUMAN	[17]
	Methylcytosine dioxygenase TET2	Regulated Protein	TET2_HUMAN	[18]
	Microphthalmia-associated transcription factor	Regulated Protein	MITF_HUMAN	[19]
	Polycomb protein EED	Regulated Protein	EED_HUMAN	[8]
	Polycomb protein SUZ12	Regulated Protein	SUZ12_HUMAN	[8]
	PR domain zinc finger protein 1	Regulated Protein	PRDM1_HUMAN	[20]
	Prostaglandin G/H synthase 2	Regulated Protein	PGH2_HUMAN	[21]
	Ras-related protein Rab-5A	Regulated Protein	RAB5A_HUMAN	[11]
	Ras-related protein Rap-1b	Regulated Protein	RAP1B_HUMAN	[22]
	Runt-related transcription factor 1	Regulated Protein	RUNX1_HUMAN	[23]
	Serine/threonine-protein kinase NLK	Regulated Protein	NLK_HUMAN	[24]
	Serum response factor	Regulated Protein	SRF_HUMAN	[25]
	Synaptic functional regulator FMR1	Regulated Protein	FMR1_HUMAN	[26]
	Transcription factor SOX-9	Regulated Protein	SOX9_HUMAN	[27]
	Zinc finger E-box-binding homeobox 1	Regulated Protein	ZEB1_HUMAN	[28]
References
REF 1	MiR-101 downregulation is involved in cyclooxygenase-2 overexpression in human colon cancer cells. Exp Cell Res. 2009 May 1;315(8):1439-47.
REF 2	miR-203 induces oxaliplatin resistance in colorectal cancer cells by negatively regulating ATM kinase. Mol Oncol. 2014 Feb;8(1):83-92.
REF 3	MYC stimulates EZH2 expression by repression of its negative regulator miR-26a. Blood. 2008 Nov 15;112(10):4202-12.
REF 4	mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007 Sep 13;26(42):6133-40.
REF 5	Roquin represses autoimmunity by limiting inducible T-cell co-stimulator messenger RNA. Nature. 2007 Nov 8;450(7167):299-303.
REF 6	Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 7	mir-101-3p is a key regulator of tumor metabolism in triple negative breast cancer targeting AMPK.Oncotarget. 2016 Jun 7;7(23):35188-98.
REF 8	Genomic loss of microRNA-101 leads to overexpression of histone methyltransferase EZH2 in cancer. Science. 2008 Dec 12;322(5908):1695-9.
REF 9	miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis.Nat Neurosci. 2008 Oct;11(10):1137-9.
REF 10	MiR-101 regulates HSV-1 replication by targeting ATP5B.Antiviral Res. 2011 Mar;89(3):219-26.
REF 11	microRNA-101 is a potent inhibitor of autophagy.EMBO J. 2011 Sep 13;30(22):4628-41.
REF 12	CPEB1, a histone-modified hypomethylated gene, is regulated by miR-101 and involved in cell senescence in glioma.Cell Death Dis. 2013 Jun 20;4:e675.
REF 13	MicroRNA-101 inhibits cell proliferation and induces apoptosis by targeting EYA1 in breast cancer.Int J Mol Med. 2016 Jun;37(6):1643-51.
REF 14	ICP4-induced miR-101 attenuates HSV-1 replication.Sci Rep. 2016 Mar 17;6:23205.
REF 15	Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3945-50.
REF 16	MicroRNA-101 inhibits invasion and angiogenesis through targeting ITGA3 and its systemic delivery inhibits lung metastasis in nasopharyngeal carcinoma.Cell Death Dis. 2017 Jan 19;8(1):e2566.
REF 17	MicroRNA-101 suppresses liver fibrosis by targeting the TGF signalling pathway.J Pathol. 2014 Sep;234(1):46-59.
REF 18	An extensive network of TET2-targeting MicroRNAs regulates malignant hematopoiesis.Cell Rep. 2013 Oct 31;5(2):471-81.
REF 19	MiR-101 inhibits melanoma cell invasion and proliferation by targeting MITF and EZH2.Cancer Lett. 2013 Dec 1;341(2):240-7.
REF 20	Uncovering MicroRNA Regulatory Hubs that Modulate Plasma Cell Differentiation.Sci Rep. 2015 Dec 11;5:17957.
REF 21	miR-101 inhibits cholangiocarcinoma angiogenesis through targeting vascular endothelial growth factor (VEGF).Am J Pathol. 2013 May;182(5):1629-39.
REF 22	Functional analysis of miR-101-3p and Rap1b involved in hepatitis B virus-related hepatocellular carcinoma pathogenesis.Biochem Cell Biol. 2014 Apr;92(2):152-62.
REF 23	The miR-101/RUNX1 feedback regulatory loop modulates chemo-sensitivity and invasion in human lung cancer. Int J Clin Exp Med. 2015 Sep 15;8(9):15030-42.
REF 24	MiR-101 functions as a tumor suppressor by directly targeting nemo-like kinase in liver cancer.Cancer Lett. 2014 Mar 28;344(2):204-11.
REF 25	miR-101-3p Suppresses HOX Transcript Antisense RNA (HOTAIR)-Induced Proliferation and Invasion Through Directly Targeting SRF in Gastric Carcinoma Cells.Oncol Res. 2017 Sep 21;25(8):1383-1390.
REF 26	The 3' UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse.Hum Mol Genet. 2013 May 15;22(10):1971-82.
REF 27	MicroRNA-101 suppresses SOX9-dependent tumorigenicity and promotes favorable prognosis of human hepatocellular carcinoma.FEBS Lett. 2012 Dec 14;586(24):4362-70.
REF 28	MiR-101 suppresses the epithelial-to-mesenchymal transition by targeting ZEB1 and ZEB2 in ovarian carcinoma.Oncol Rep. 2014 May;31(5):2021-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.