Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T86591 Target Info
Target Name Peroxisome proliferator-activated receptor alpha (PPARA)
Synonyms Peroxisome proliferater-activated receptor alpha; PPARalpha; PPAR-alpha; PPAR; Nuclear receptor subfamily 1 group C member 1; NR1C1
Target Type Successful Target
Gene Name PPARA
Biochemical Class Nuclear hormone receptor
UniProt ID
Q07869
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-21-5p by mature miRNA precursor transfection resulted in the decreased protein level of target PPARA. [3]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; Immunoprecipitation; In Situ Hybridization; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism The PPAR-a protein level decreased and increased significantly after the overexpression and knockdown of miRNA-10b, respectively. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Western Blot [6]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130b expression was significantly increased, leading to target gene PPARA was significantly suppressed. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-22-3p resulted in the decreased protein level of target PPARA. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Regulation Mechanism PPARA mRNA and protein were down-regulated in miR-33a transfected Lx-2 cells comparewith the negative control microRNA transfected cells. [10]
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [10]
2 Western Blot [10]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-27a-5p miRNA Info
miRNA Mature AC
MIMAT0004501
Sequence agggcuuagcugcuugugagca
miRNA Species Homo sapiens
Regulation Mechanism PPARA is direct target of miRNA-27a. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Gremlin-1 (Gremlin-1) Target Info
GREM1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The upregulation of miR-34a-5p resulted in the downregulation of hepatic PPARA that is the direct target of miR-34a. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-519d-3p miRNA Info
miRNA Mature AC
MIMAT0002853
Sequence caaagugccucccuuuagagug
miRNA Species Homo sapiens
Regulation Mechanism Pre-miR-519d dose-dependently inhibited the expression of a Renilla luciferase-expressing construct that contains the 3` UTR region of the PPARA gene harboring miR-519d putative binding sites. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Calcium-release activated calcium channel (CRACM) Target Info
CRCM1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
References  Top
REF 1 MicroRNA-21 targets peroxisome proliferators-activated receptor-alpha in an autoregulatory loop to modulate flow-induced endothelial inflammation. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10355-60.
REF 2 Blockage of a miR-21/EGFR regulatory feedback loop augments anti-EGFR therapy in glioblastomas. Cancer Lett. 2014 Jan 1;342(1):139-49.
REF 3 Michael T. McManus: Interrupting biology [interview by Hema Bashyam]. J Exp Med. 2008 Mar 17;205(3):506-7.
REF 4 Liver microRNA-21 is overexpressed in non-alcoholic steatohepatitis and contributes to the disease in experimental models by inhibiting PPAR expression. Gut. 2016 Nov;65(11):1882-1894.
REF 5 Effect of miRNA-10b in regulating cellular steatosis level by targeting PPAR-alpha expression, a novel mechanism for the pathogenesis of NAFLD. J Gastroenterol Hepatol. 2010 Jan;25(1):156-63.
REF 6 MicroRNAs-Dependent Regulation of PPARs in Metabolic Diseases and Cancers. PPAR Res. 2017;2017:7058424.
REF 7 MicroRNA-130b promotes lung cancer progression via PPAR/VEGF-A/BCL-2-mediated suppression of apoptosis. J Exp Clin Cancer Res. 2016 Jul 1;35(1):105.
REF 8 Intravenous injection of microvesicle-delivery miR-130b alleviates high-fat diet-induced obesity in C57BL/6 mice through translational repression of PPAR-. J Biomed Sci. 2015 Oct 16;22:86.
REF 9 Integrative microRNA and proteomic approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory networks. PLoS One. 2008;3(11):e3740.
REF 10 Profibrotic effect of miR-33a with Akt activation in hepatic stellate cells. Cell Signal. 2014 Jan;26(1):141-8.
REF 11 Systems-level regulation of microRNA networks by miR-130/301 promotes pulmonary hypertension. J Clin Invest. 2014 Aug;124(8):3514-28.
REF 12 MicroRNA-141 represses HBV replication by targeting PPARA. PLoS One. 2012;7(3):e34165.
REF 13 miR-27a attenuates adipogenesis and promotes osteogenesis in steroid-induced rat BMSCs by targeting PPAR and GREM1. Sci Rep. 2016 Dec 2;6:38491.
REF 14 Effect of miR-34a in regulating steatosis by targeting PPAR expression in nonalcoholic fatty liver disease. Sci Rep. 2015 Sep 2;5:13729.
REF 15 miR-519d overexpression is associated with human obesity. Obesity (Silver Spring). 2010 Nov;18(11):2170-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.