miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-27a-5p | ||||
| miRNA Stemloop AC | MI0000085 | ||||
| miRNA Stemloop ID | hsa-mir-27a | ||||
| Sequence | agggcuuagcugcuugugagca | ||||
| TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
| Peroxisome proliferator-activated receptor alpha (PPARA) | Successful Target | Target Info | [2] | ||
| Synaptosomal-associated protein 25 (SNAP25) | Successful Target | Target Info | [3] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [4] | ||
| Gremlin-1 (Gremlin-1) | Patented-recorded Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Max-interacting protein 1 | Regulated Protein | [5] | ||
| Phosphatidylethanolamine-binding protein 1 | Regulated Protein | [6] | |||
| Secreted frizzled-related protein 1 | Regulated Protein | [7] | |||
| Thioredoxin, mitochondrial | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | MicroRNA-27a functions as a tumor suppressor in renal cell carcinoma by targeting epidermal growth factor receptor. Oncol Lett. 2016 Jun;11(6):4217-4223. | ||||
| REF 2 | miR-27a attenuates adipogenesis and promotes osteogenesis in steroid-induced rat BMSCs by targeting PPAR and GREM1. Sci Rep. 2016 Dec 2;6:38491. | ||||
| REF 3 | MicroRNA miR-27 Inhibits Adenovirus Infection by Suppressing the Expression of SNAP25 and TXN2. J Virol. 2017 May 26;91(12). pii: e00159-17. | ||||
| REF 4 | Coordinated targeting of the EGFR signaling axis by microRNA-27a*. Oncotarget. 2013 Sep;4(9):1388-98. | ||||
| REF 5 | miR-24-3p and miR-27a-3p promote cell proliferation in glioma cells via cooperative regulation of MXI1.Int J Oncol. 2013 Feb;42(2):757-66. | ||||
| REF 6 | miR-27a regulates cisplatin resistance and metastasis by targeting RKIP in human lung adenocarcinoma cells.Mol Cancer. 2014 Aug 16;13:193. | ||||
| REF 7 | MiR-27a targets sFRP1 in hFOB cells to regulate proliferation, apoptosis and differentiation.PLoS One. 2014 Mar 13;9(3):e91354. | ||||
| REF 8 | MicroRNA miR-27 Inhibits Adenovirus Infection by Suppressing the Expression of SNAP25 and TXN2. J Virol. 2017 May 26;91(12). pii: e00159-17. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.