Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T57059 Target Info
Target Name E2F transcription factor 1 (E2F1)
Synonyms pRB-binding protein E2F-1; Transcription factor E2F1; Retinoblastoma-binding protein 3; Retinoblastoma-associated protein 1; RBBP3; RBBP-3; RBAP-1; PBR3; E2F-1
Target Type Clinical trial Target
Gene Name E2F1
UniProt ID
Q01094
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-20a-5p by Anti-miRNA Oligonucleotides resulted in the increased protein level of target E2F1. [3]
Evidence Score (E-score) 7 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Western Blot [5]
6 Western Blot [6]
7 Western Blot [7]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-106b-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target E2F1. [3]
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay [2]
2 Luciferase Reporter Assay [3]
3 Luciferase Reporter Assay; Microarray; Western Blot [8]
4 Luciferase Reporter Assay; qRT-PCR [9]
5 Luciferase Reporter Assay; Western Blot [10]
6 Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The endogenously expressed miRNAs decrease E2F1 expression by recognizing specific sites. [3]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [2]
2 Luciferase Reporter Assay; Northern Blot; Western Blot [3]
3 Northern Blot; qRT-PCR; Western Blot [12]
4 Western Blot [6]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism Introduction of miR-34a decreased the accumulation of E2F-1. And miR-34a functions as a potent suppressor of cell proliferation through modulation of the E2F signaling pathway. [13]
Evidence Score (E-score) 4 +
1 Immunoblot; Immunohistochemistry [13]
2 Luciferase Reporter Assay; Western Blot [14]
3 qRT-PCR; Western Blot [15]
4 Western Blot [16]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Microarray; Western Blot [17]
2 Luciferase Reporter Assay; Western Blot [18]
3 qRT-PCR [19]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism miR-205 directly targets E2F1. [22]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [20]
2 Luciferase Reporter Assay; Western Blot [21]
3 Reporter Assay [22]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-21-5p by mature miRNA precursor transfection resulted in the decreased protein level of target E2F1. [3]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [23]
2 Luciferase Reporter Assay [3]
3 qRT-PCR; Western Blot [24]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-93-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target E2F1. [3]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Microarray; Western Blot [8]
2 Luciferase Reporter Assay; Microarray; Western Blot [3]
3 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-330-3p miRNA Info
miRNA Mature AC
MIMAT0000751
Sequence gcaaagcacacggccugcagaga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-330-3p by mature miRNA precursor transfection resulted in the decreased protein level of target E2F1. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [25]
2 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-519d-3p miRNA Info
miRNA Mature AC
MIMAT0002853
Sequence caaagugccucccuuuagagug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [26]
2 Luciferase Reporter Assay [27]
Representative Target(s) Regulated by This miRNA Calcium-release activated calcium channel (CRACM) Target Info
CRCM1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [19]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism The mRNA expression of E2F1 is downregulated following transfection with miR-193a-3p. [28]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [28]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism E2F1 is a direct target of miR-223. [30]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [30]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism The PS-induced miR-23b expression can cause growth arrest through downregulation of E2F family proteins and Rb hypophosphorylation. [31]
Evidence Score (E-score) 1 +
1 Microarray [31]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism miR-302b overexpression in MDA-MB-231 cells resulted in the decrease of E2F1 expression both at the mRNA and protein levels. [32]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [32]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-331-3p miRNA Info
miRNA Mature AC
MIMAT0000760
Sequence gccccugggccuauccuagaa
miRNA Species Homo sapiens
Regulation Mechanism miR-331-3p targets 3' -UTR of E2F1 gene. [33]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [33]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-342-3p miRNA Info
miRNA Mature AC
MIMAT0000753
Sequence ucucacacagaaaucgcacccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-342-3p can target 3'UTR of E2F1 to regulate E2F1. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism E2 induced the expression of miR-98 reduced the levels of E2F2 protein. [23]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [23]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-149-3p miRNA Info
miRNA Mature AC
MIMAT0004609
Sequence agggagggacgggggcugugc
miRNA Species Homo sapiens
Regulation Mechanism E2F1 is a direct targets of miR-149. [35]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [35]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Fibroblast growth factor receptor 1 (FGFR1) Target Info
FGFR1_HUMAN
miRNA Mature ID hsa-miR-362-3p miRNA Info
miRNA Mature AC
MIMAT0004683
Sequence aacacaccuauucaaggauuca
miRNA Species Homo sapiens
Regulation Mechanism E2F1 is direct miR-362-3p targets. [36]
Evidence Score (E-score) 1 +
1 Western Blot [36]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Protein-tyrosine phosphatase 1B (PTP1B) Target Info
PTN1_HUMAN
References  Top
REF 1 E2F1-miR-20a-5p/20b-5p auto-regulatory feedback loop involved in myoblast proliferation and differentiation. Sci Rep. 2016 Jun 10;6:27904.
REF 2 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 3 c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43.
REF 4 MiR-19b/20a/92a regulates the self-renewal and proliferation of gastric cancer stem cells. J Cell Sci. 2013 Sep 15;126(Pt 18):4220-9.
REF 5 MicroRNA regulation of Alzheimer's Amyloid precursor protein expression. Neurobiol Dis. 2009 Mar;33(3):422-8.
REF 6 miR-17 and miR-20a temper an E2F1-induced G1 checkpoint to regulate cell cycle progression. Oncogene. 2009 Jan 8;28(1):140-5.
REF 7 Lentivirus-mediated antagomir expression for specific inhibition of miRNA function. Nucleic Acids Res. 2007;35(22):e149.
REF 8 E2F1-regulated microRNAs impair TGFbeta-dependent cell-cycle arrest and apoptosis in gastric cancer. Cancer Cell. 2008 Mar;13(3):272-86.
REF 9 Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer. Cancer Res. 2008 Aug 1;68(15):6162-70.
REF 10 Role of the miR-106b-25 microRNA cluster in hepatocellular carcinoma. Cancer Sci. 2009 Jul;100(7):1234-42.
REF 11 MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression. Mol Cell Biol. 2008 Apr;28(7):2167-74.
REF 12 Mir-17-5p regulates breast cancer cell proliferation by inhibiting translation of AIB1 mRNA. Mol Cell Biol. 2006 Nov;26(21):8191-201.
REF 13 Tumor-suppressive miR-34a induces senescence-like growth arrest through modulation of the E2F pathway in human colon cancer cells. Proc Natl Acad Sci U S A. 2007 Sep 25;104(39):15472-7.
REF 14 rs35301225 polymorphism in miR-34a promotes development of human colon cancer by deregulation of 3'UTR in E2F1 in Chinese population. Cancer Cell Int. 2017 Mar 9;17:39.
REF 15 E2F-1 promotes DAPK2-induced anti-tumor immunity of gastric cancer cells by targeting miR-34a. Tumour Biol. 2016 Oct 4. [Epub ahead of print]
REF 16 Upregulation of p18Ink4c expression by oncogenic HPV E6 via p53-miR-34a pathway. Int J Cancer. 2011 Sep 15;129(6):1362-72.
REF 17 microRNAome changes in bystander three-dimensional human tissue models suggest priming of apoptotic pathways. Carcinogenesis. 2010 Oct;31(10):1882-8.
REF 18 MiR-106a inhibits glioma cell growth by targeting E2F1 independent of p53 status. J Mol Med (Berl). 2011 Oct;89(10):1037-50.
REF 19 Deregulated expression of miR-106a predicts survival in human colon cancer patients. Genes Chromosomes Cancer. 2008 Sep;47(9):794-802.
REF 20 Oncosuppressive role of p53-induced miR-205 in triple negative breast cancer. Mol Oncol. 2012 Aug;6(4):458-72.
REF 21 Chemically modified synthetic microRNA-205 inhibits the growth of melanoma cells in vitro and in vivo. Mol Ther. 2013 Jun;21(6):1204-11.
REF 22 miRNA-205 suppresses melanoma cell proliferation and induces senescence via regulation of E2F1 protein. J Biol Chem. 2011 May 13;286(19):16606-14.
REF 23 Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res. 2009 Aug;37(14):4850-61.
REF 24 microRNA 21: response to hormonal therapies and regulatory function in leiomyoma, transformed leiomyoma and leiomyosarcoma cells. Mol Hum Reprod. 2010 Mar;16(3):215-27.
REF 25 MicroRNA-330 acts as tumor suppressor and induces apoptosis of prostate cancer cells through E2F1-mediated suppression of Akt phosphorylation. Oncogene. 2009 Sep 24;28(38):3360-70.
REF 26 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 27 E2F-1 targets miR-519d to regulate the expression of the ras homolog gene family member C. Oncotarget. 2017 Feb 28;8(9):14777-14793.
REF 28 miR-193a-3p is a potential tumor suppressor in malignant pleural mesothelioma. Oncotarget. 2015 Sep 15;6(27):23480-95.
REF 29 Regulatory Role of mir-203 in Prostate Cancer Progression and Metastasis. Clin Cancer Res. 2011 Aug 15;17(16):5287-98.
REF 30 Cell-cycle regulator E2F1 and microRNA-223 comprise an autoregulatory negative feedback loop in acute myeloid leukemia. Blood. 2010 Mar 4;115(9):1768-78.
REF 31 Role of microRNA-23b in flow-regulation of Rb phosphorylation and endothelial cell growth. Proc Natl Acad Sci U S A. 2010 Feb 16;107(7):3234-9.
REF 32 miR-302b enhances breast cancer cell sensitivity to cisplatin by regulating E2F1 and the cellular DNA damage response. Oncotarget. 2016 Jan 5;7(1):786-97.
REF 33 miRNA-331-3p directly targets E2F1 and induces growth arrest in human gastric cancer. Biochem Biophys Res Commun. 2010 Jul 16;398(1):1-6.
REF 34 miR-342-3p regulates MYC transcriptional activity via direct repression of E2F1 in human lung cancer. Carcinogenesis. 2015 Dec;36(12):1464-73.
REF 35 miR-149* induces apoptosis by inhibiting Akt1 and E2F1 in human cancer cells. Mol Carcinog. 2010 Aug;49(8):719-27.
REF 36 MiRNA-362-3p induces cell cycle arrest through targeting of E2F1, USF2 and PTPN1 and is associated with recurrence of colorectal cancer. Int J Cancer. 2013 Jul;133(1):67-78.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.