miRNA General Information
miRNA Mature ID	hsa-miR-362-3p
miRNA Stemloop AC	MI0000762
miRNA Stemloop ID	hsa-mir-362
Sequence	aacacaccuauucaaggauuca
TTD Target(s) Regulated by This miRNA	Protein-tyrosine phosphatase 1B (PTP1B)	Clinical trial Target	Target Info	[1]
	E2F transcription factor 1 (E2F1)	Clinical trial Target	Target Info	[1]
Protein(s) Regulated by This miRNA	Breast cancer anti-estrogen resistance protein 1	Regulated Protein	BCAR1_HUMAN	[2]
	CD82 antigen	Regulated Protein	CD82_HUMAN	[3]
	Upstream stimulatory factor 2	Regulated Protein	USF2_HUMAN	[1]
References
REF 1	MiRNA-362-3p induces cell cycle arrest through targeting of E2F1, USF2 and PTPN1 and is associated with recurrence of colorectal cancer. Int J Cancer. 2013 Jul;133(1):67-78.
REF 2	Downregulation of microRNA-362-3p and microRNA-329 promotes tumor progression in human breast cancer.Cell Death Differ. 2016 Mar;23(3):484-95.
REF 3	Anti-miR-362-3p Inhibits Migration and Invasion of Human Gastric Cancer Cells by Its Target CD82.Dig Dis Sci. 2015 Jul;60(7):1967-76.
REF 4	MiRNA-362-3p induces cell cycle arrest through targeting of E2F1, USF2 and PTPN1 and is associated with recurrence of colorectal cancer. Int J Cancer. 2013 Jul;133(1):67-78.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.