Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38983 Target Info
Target Name Protein C-ets-1 (ETS1)
Synonyms P54; EWSR2
Target Type Literature-reported Target
Gene Name ETS1
Biochemical Class E26 transformation-specific ETS
UniProt ID
P14921
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauaggggu
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 qRT-PCR; Western Blot [3]
4 Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism HUVECs highly expressed miR-155 may co-target AT1R and Ets-1 while miR-222 targets Ets-1, which indirectly regulate the expression of several inflammatory molecules of ECs, and therefore attenuate the adhesion of Jurkat T cells to activated HUVECs and reduce HUVECs migration. These findings present possible therapeutic targets in atherosclerosis. [1]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; Microarray; Next Generation Sequencing; qRT-PCR [5]
2 Luciferase Reporter Assay; Northern Blot; Western Blot [1]
3 Luciferase Reporter Assay; qRT-PCR [6]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism HUVECs highly expressed miR-155 may co-target AT1R and Ets-1 while miR-221 targets Ets-1, which indirectly regulate the expression of several inflammatory molecules of ECs, and therefore attenuate the adhesion of Jurkat T cells to activated HUVECs and reduce HUVECs migration. [1]
Evidence Score (E-score) 3 +
1 Immunocytochemistry; Microarray; qRT-PCR; Western Blot [8]
2 Luciferase Reporter Assay; Microarray; Next Generation Sequencing; qRT-PCR [5]
3 Luciferase Reporter Assay; Northern Blot; Western Blot [1]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism ETS-1 is a molecular target of miR-144-3p. [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [9]
2 Western Blot [10]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-193b-3p miRNA Info
miRNA Mature AC
MIMAT0002819
Sequence aacuggcccucaaagucccgcu
miRNA Species Homo sapiens
Regulation Mechanism miR-193b directly represses the expressions of ETS1 through its 3'UTR. [12]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [11]
2 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA DNA repair protein RAD51 homolog 1 (RAD51) Target Info
RAD51_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 overexpression resulted in decreased protein and transcript levels of Ets1 in gastric cancer cells. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Immunohistochemistry [13]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism miR-200b is involved in induction of angiogenesis via directly targeting Ets-1 in HMECs. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-200c results in the negative regulation of ETS1. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [16]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [17]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-324-5p miRNA Info
miRNA Mature AC
MIMAT0000761
Sequence cgcauccccuagggcauuggug
miRNA Species Homo sapiens
Regulation Mechanism miR-324-5p directly targets and downregulates ETS1. [18]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
miRNA Mature ID hsa-miR-506-3p miRNA Info
miRNA Mature AC
MIMAT0002878
Sequence uaaggcacccuucugaguaga
miRNA Species Homo sapiens
Regulation Mechanism ETS1 was a miR-506 target. [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Immunohistochemistry [19]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-208a-3p miRNA Info
miRNA Mature AC
MIMAT0000241
Sequence auaagacgagcaaaaagcuugu
miRNA Species Homo sapiens
Regulation Mechanism Ets1 is a target gene of miR-208 by using a sensor luciferase reporter assay. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
miRNA Mature ID hsa-miR-499a-5p miRNA Info
miRNA Mature AC
MIMAT0002870
Sequence uuaagacuugcagugauguuu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-499 in HepG2 cells led to downregulation of ets1 mRNA and protein. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
References  Top
REF 1 Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis. 2011 Apr;215(2):286-93.
REF 2 MicroRNA 155 modulates megakaryopoiesis at progenitor and precursor level by targeting Ets-1 and Meis1 transcription factors. Br J Haematol. 2008 Nov;143(4):570-80.
REF 3 Autoantibody induction by DNA-containing immune complexes requires HMGB1 with the TLR2/microRNA-155 pathway. J Immunol. 2013 Jun 1;190(11):5411-22.
REF 4 Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 5 miRNome traits analysis on endothelial lineage cells discloses biomarker potential circulating microRNAs which affect progenitor activities. BMC Genomics. 2014 Sep 18;15:802.
REF 6 MicroRNA profiling reveals aberrant microRNA expression in adult ETP-ALL and functional studies implicate a role for miR-222 in acute leukemia. Leuk Res. 2013 Jun;37(6):647-56.
REF 7 Constitutive activation of the ETS-1-miR-222 circuitry in metastatic melanoma. Pigment Cell Melanoma Res. 2011 Oct;24(5):953-65.
REF 8 MicroRNA221-3p modulates Ets-1 expression in synovial fibroblasts from patients with osteoarthritis of temporomandibular joint. Osteoarthritis Cartilage. 2016 Nov;24(11):2003-2011.
REF 9 miR-144-3p, a tumor suppressive microRNA targeting ETS-1 in laryngeal squamous cell carcinoma. Oncotarget. 2016 Mar 8;7(10):11637-50.
REF 10 Valproic acid regulates erythro-megakaryocytic differentiation through the modulation of transcription factors and microRNA regulatory micro-networks. Biochem Pharmacol. 2014 Nov 15;92(2):299-311.
REF 11 MiR-193b Mediates CEBPD-Induced Cisplatin Sensitization Through Targeting ETS1 and Cyclin D1 in Human Urothelial Carcinoma Cells. J Cell Biochem. 2017 Jun;118(6):1563-1573.
REF 12 MicroRNA-193b regulates proliferation, migration and invasion in human hepatocellular carcinoma cells. Eur J Cancer. 2010 Oct;46(15):2828-36.
REF 13 miRNA-145 targets v-ets erythroblastosis virus E26 oncogene homolog 1 to suppress the invasion, metastasis, and angiogenesis of gastric cancer cells. Mol Cancer Res. 2013 Feb;11(2):182-93.
REF 14 miR-200b targets Ets-1 and is down-regulated by hypoxia to induce angiogenic response of endothelial cells. J Biol Chem. 2011 Jan 21;286(3):2047-56.
REF 15 MicroRNA-200c modulates epithelial-to-mesenchymal transition (EMT) in human colorectal cancer metastasis. Gut. 2013 Sep;62(9):1315-26.
REF 16 The reciprocal regulation loop of Notch2 pathway and miR-23b in controlling gastric carcinogenesis. Oncotarget. 2015 Jul 20;6(20):18012-26.
REF 17 A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell. 2009 Jun 12;137(6):1032-46.
REF 18 MiR-324-5p Suppresses Hepatocellular Carcinoma Cell Invasion by Counteracting ECM Degradation through Post-Transcriptionally Downregulating ETS1 and SP1. PLoS One. 2015 Jul 15;10(7):e0133074.
REF 19 miR-506 Inhibits Epithelial-to-Mesenchymal Transition and Angiogenesis in Gastric Cancer. Am J Pathol. 2015 Sep;185(9):2412-20.
REF 20 MicroRNA-208 modulates BMP-2-stimulated mouse preosteoblast differentiation by directly targeting V-ets erythroblastosis virus E26 oncogene homolog 1. J Biol Chem. 2010 Sep 3;285(36):27745-52.
REF 21 MicroRNA-1 and microRNA-499 downregulate the expression of the ets1 proto-oncogene in HepG2 cells. Oncol Rep. 2012 Aug;28(2):701-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.