Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T14143 Target Info
Target Name Transforming growth factor beta 2 (TGFB2)
Synonyms Transforming growth factor beta-2 proprotein; TGF-beta 2; Polyergin; Glioblastoma-derived T-cell suppressor factor; G-TSF; Cetermin; BSC-1 cell growth inhibitor
Target Type Clinical trial Target
Gene Name TGFB2
Biochemical Class Growth factor
UniProt ID
P61812
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-141-3p by mature miRNA precursor transfection resulted in the decreased protein level of target TGFB2; The Underexpression by Anti-miRNA Oligonucleotides resulted in the changed mRNA level of target TGFB2. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism Overexpressing of miR-21 could suppress the activation of TGF-b/SMAD2 pathway and there by inhibit the differentiation of fibroblaststomyo- fibroblasts by targeting TGF-b2. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Microarray [4]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-378a-3p miRNA Info
miRNA Mature AC
MIMAT0000732
Sequence acuggacuuggagucagaaggc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [5]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Aromatase (CYP19A1) Target Info
CP19A_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism miR-142-5p expression may regulate apoptosis in human macrophages by targeting TGF-b2. [7]
Evidence Score (E-score) 1 +
1 Western Blot [7]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 could targets TGF- b2. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148a inhibited the proliferation, migration, invasion and expression of TGFB2 in gastric cancer cells. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism miR-193b-3p could regulate trophoblasts migration and invasion through binding onto the 3'UTR target site of TGF-b2. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism miR-200a inhibited TGF-B2 expressions in glioma cells by directly targeting the 3'UTR of oncogene TGF-B2. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-23a-5p miRNA Info
miRNA Mature AC
MIMAT0004496
Sequence gggguuccuggggaugggauuu
miRNA Species Homo sapiens
Regulation Mechanism miR-23a could targets TGF- b2. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Gap junction alpha-1 protein (GJA1) Target Info
CXA1_HUMAN
Lysosome-associated membrane glycoprotein 1 (CD107a) Target Info
LAMP1_HUMAN
miRNA Mature ID hsa-miR-23b-5p miRNA Info
miRNA Mature AC
MIMAT0004587
Sequence uggguuccuggcaugcugauuu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
TGF-beta receptor type II (TGFBR2) Target Info
TGFR2_HUMAN
References  Top
REF 1 Lnc-ATB contributes to gastric cancer growth through a MiR-141-3p/TGF2 feedback loop. Biochem Biophys Res Commun. 2017 Mar 11;484(3):514-521.
REF 2 A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. EMBO Rep. 2008 Jun;9(6):582-9.
REF 3 Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016 Oct;5(10):1425-1439.
REF 4 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
REF 5 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
REF 6 The Epigenetically-Regulated microRNA-378a Targets TGF-2 in TGF-1-Treated Hepatic Stellate Cells. Cell Physiol Biochem. 2016;40(1-2):183-194.
REF 7 Upregulation of miR-142-5p in atherosclerotic plaques and regulation of oxidized low-density lipoprotein-induced apoptosis in macrophages. Mol Med Rep. 2015 May;11(5):3229-34.
REF 8 miR-148a downregulates the expression of transforming growth factor-2 and SMAD2 in gastric cancer. Int J Oncol. 2016 May;48(5):1877-85.
REF 9 The aberrantly expressed miR-193b-3p contributes to preeclampsia through regulating transforming growth factor- signaling. Sci Rep. 2016 Jan 29;6:19910.
REF 10 Long non-coding RNA ATB promotes glioma malignancy by negatively regulating miR-200a. J Exp Clin Cancer Res. 2016 Jun 6;35(1):90.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.