Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T10052 Target Info
Target Name G1/S-specific cyclin-E1 (CCNE1)
Synonyms G1/S-specific cyclin E; Cyclin E; CCNE
Target Type Literature-reported Target
Gene Name CCNE1
UniProt ID
P24864
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism Treatment with pre-miR-15a reduced cyclin E1-dependent luciferase activity in cells transfected with the Wt cyclin E 3'UTR. By contrast, no reduction was observed with the Mut cyclin E 3'UTR, confirming that miR-15a directly inhibits cyclin E1 translation via binding to its 3'UTR at the predicted sites. [1]
Evidence Score (E-score) 5 +
1 Immunohistochemistry; Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 qRT-PCR; Luciferase Reporter Assay; Western Blot [4]
5 Western Blot [5]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [6]
2 Luciferase Reporter Assay [7]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
4 qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism CCNE1 was the target of miR-424. [11]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; qRT-PCR; Western Blot [10]
2 Luciferase Reporter Assay [11]
3 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [12]
2 Luciferase Reporter Assay; Western Blot [13]
3 PAR-CLIP [14]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Western Blot [15]
2 Luciferase Reporter Assay; Western Blot [13]
3 PAR-CLIP [14]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-107 by mature miRNA mimics tranfection resulted in the changed mRNA level of target CCNE1. [7]
Evidence Score (E-score) 2 +
1 Immunoblot; Microarray; qRT-PCR [16]
2 Immunoblot; Microarray; qRT-PCR [7]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-185-5p by mature miRNA mimics tranfection resulted in the changed mRNA level of target CCNE1. [7]
Evidence Score (E-score) 2 +
1 Immunoblot; Microarray; qRT-PCR [16]
2 Immunoblot; Microarray; qRT-PCR [7]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-503-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CCNE1. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [11]
2 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p resulted in the decreased protein level of target CCNE1. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-144-5p miRNA Info
miRNA Mature AC
MIMAT0004600
Sequence ggauaucaucauauacuguaag
miRNA Species Homo sapiens
Regulation Mechanism CCNE1 is directly regulated by miR-144-5p and might be good prognostic markers for survival of BC patients. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [17]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
G1/S-specific cyclin-E2 (CCNE2) Target Info
CCNE2_HUMAN
miRNA Mature ID hsa-miR-16-1-3p miRNA Info
miRNA Mature AC
MIMAT0004489
Sequence ccaguauuaacugugcugcuga
miRNA Species Homo sapiens
Regulation Mechanism CCNE1 is a direct target of miR-16-1. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-892b miRNA Info
miRNA Mature AC
MIMAT0004918
Sequence cacuggcuccuuucuggguaga
miRNA Species Homo sapiens
Regulation Mechanism The expression of cyclin D1 is significantly reduced in miR-892b transfectants. [20]
Evidence Score (E-score) 1 +
1 Immunoblot [20]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-103a-3p miRNA Info
miRNA Mature AC
MIMAT0000101
Sequence agcagcauuguacagggcuauga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
miRNA Mature ID hsa-miR-151a-3p miRNA Info
miRNA Mature AC
MIMAT0000757
Sequence cuagacugaagcuccuugagg
miRNA Species Homo sapiens
Regulation Mechanism miR-151 directly binds to the target site on the 3'UTR of CCNE1. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
Interleukin 12 receptor beta-2 (IL12RB2) Target Info
I12R2_HUMAN
miRNA Mature ID hsa-miR-25-5p miRNA Info
miRNA Mature AC
MIMAT0004498
Sequence aggcggagacuugggcaauug
miRNA Species Homo sapiens
Regulation Mechanism miR-25 has anti-apoptosis roles in AGS cells, possibly via inhibiting FBXW7 and thus promoting oncogene CCNE1. [22]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
Protein kinase C zeta (PRKCZ) Target Info
KPCZ_HUMAN
miRNA Mature ID hsa-miR-30c-2-3p miRNA Info
miRNA Mature AC
MIMAT0004550
Sequence cugggagaaggcuguuuacucu
miRNA Species Homo sapiens
Regulation Mechanism CCNE is a target of miR-30c-2-3p by its 3'UTR. [23]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
References  Top
REF 1 A feed-forward loop involving protein kinase Calpha and microRNAs regulates tumor cell cycle. Cancer Res. 2009 Jan 1;69(1):65-74.
REF 2 miR-15a and miR-16 are implicated in cell cycle regulation in a Rb-dependent manner and are frequently deleted or down-regulated in non-small cell lung cancer. Cancer Res. 2009 Jul 1;69(13):5553-9.
REF 3 MiR-15a is underexpressed and inhibits the cell cycle by targeting CCNE1 in breast cancer. Int J Oncol. 2013 Oct;43(4):1212-8.
REF 4 DLEU2, frequently deleted in malignancy, functions as a critical host gene of the cell cycle inhibitory microRNAs miR-15a and miR-16-1. Exp Cell Res. 2009 Oct 15;315(17):2941-52.
REF 5 E2F7 overexpression leads to tamoxifen resistance in breast cancer cells by competing with E2F1 at miR-15a/16 promoter. Oncotarget. 2015 Oct 13;6(31):31944-57.
REF 6 miR-21 plays a pivotal role in gastric cancer pathogenesis and progression. Lab Invest. 2008 Dec;88(12):1358-66.
REF 7 miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404.
REF 8 MicroRNA-15b regulates cell cycle progression by targeting cyclins in glioma cells. Biochem Biophys Res Commun. 2009 Mar 6;380(2):205-10.
REF 9 MicroRNA-15b is induced with E2F-controlled genes in HPV-related cancer. Br J Cancer. 2011 Nov 22;105(11):1719-25.
REF 10 Down-regulation of mir-424 contributes to the abnormal angiogenesis via MEK1 and cyclin E1 in senile hemangioma: its implications to therapy. PLoS One. 2010 Dec 14;5(12):e14334.
REF 11 Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 12 MicroRNA-195 inhibits the proliferation of human glioma cells by directly targeting cyclin D1 and cyclin E1. PLoS One. 2013;8(1):e54932.
REF 13 The tumor-suppressive miR-497-195 cluster targets multiple cell-cycle regulators in hepatocellular carcinoma. PLoS One. 2013;8(3):e60155.
REF 14 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 15 MiRNA-497 regulates cell growth and invasion by targeting cyclin E1 in breast cancer. Cancer Cell Int. 2013 Oct 10;13(1):95.
REF 16 MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677.
REF 17 Tumour-suppressive microRNA-144-5p directly targets CCNE1/2 as potential prognostic markers in bladder cancer. Br J Cancer. 2015 Jul 14;113(2):282-9.
REF 18 Down-regulation of the cyclin E1 oncogene expression by microRNA-16-1 induces cell cycle arrest in human cancer cells. BMB Rep. 2009 Nov 30;42(11):725-30.
REF 19 MicroRNA-26a/b and their host genes cooperate to inhibit the G1/S transition by activating the pRb protein. Nucleic Acids Res. 2012 May;40(10):4615-25.
REF 20 MicroRNA-892b influences proliferation, migration and invasion of bladder cancer cells by mediating the p19ARF/cyclin D1/CDK6 and Sp-1/MMP-9 pathways. Oncol Rep. 2016 Oct;36(4):2313-20.
REF 21 A miR-151 binding site polymorphism in the 3'-untranslated region of the cyclin E1 gene associated with nasopharyngeal carcinoma. Biochem Biophys Res Commun. 2013 Mar 22;432(4):660-5.
REF 22 microRNA-25 Inhibits Cell Apoptosis of Human Gastric Adenocarcinoma Cell Line AGS via Regulating CCNE1 and MYC. Med Sci Monit. 2016 Apr 27;22:1415-20.
REF 23 MicroRNA-30c-2-3p negatively regulates NF-B signaling and cell cycle progression through downregulation of TRADD and CCNE1 in breast cancer. Mol Oncol. 2015 Jun;9(6):1106-19.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.