miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-103a-3p | ||||
miRNA Stemloop AC | MI0000108 | MI0000109 | ||||
miRNA Stemloop ID | hsa-mir-103-2 | hsa-mir-103-1 | ||||
Sequence | agcagcauuguacagggcuauga | ||||
TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [1] | |
Inducible T-cell costimulator (ICOS) | Clinical trial Target | Target Info | [2] | ||
G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [3] | ||
Cyclic AMP-responsive element-binding protein (CREB1) | Literature-reported Target | Target Info | [4] | ||
Protein(s) Regulated by This miRNA | BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 | Regulated Protein | [5] | ||
Cytochrome P450 2C8 | Regulated Protein | [6] | |||
Death-associated protein kinase 1 | Regulated Protein | [7] | |||
Metalloproteinase inhibitor 3 | Regulated Protein | [8] | |||
Myocyte-specific enhancer factor 2D | Regulated Protein | [9] | |||
Olfactomedin-4 | Regulated Protein | [10] | |||
Piezo-type mechanosensitive ion channel component 1 | Regulated Protein | [11] | |||
Protein argonaute-1 | Regulated Protein | [12] | |||
Retinoic acid-induced protein 3 | Regulated Protein | [13] | |||
Segment polarity protein dishevelled homolog DVL-1 | Regulated Protein | [14] | |||
References | |||||
REF 1 | Global microRNA characterization reveals that miR-103 is involved in IGF-1 stimulated mouse intestinal cell proliferation. PLoS One. 2010 Sep 23;5(9):e12976. | ||||
REF 2 | Roquin represses autoimmunity by limiting inducible T-cell co-stimulator messenger RNA. Nature. 2007 Nov 8;450(7167):299-303. | ||||
REF 3 | miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404. | ||||
REF 4 | miR-34b targets cyclic AMP-responsive element binding protein in acute myeloid leukemia. Cancer Res. 2009 Mar 15;69(6):2471-8. | ||||
REF 5 | miR-103 Regulates Oxidative Stress by Targeting the BCL2/Adenovirus E1B 19Da Interacting Protein 3 in HUVECs.Oxid Med Cell Longev. 2015;2015:489647. | ||||
REF 6 | Human CYP2C8 is post-transcriptionally regulated by microRNAs 103 and 107 in human liver.Mol Pharmacol. 2012 Sep;82(3):529-40. | ||||
REF 7 | miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4. Cancer Res. 2012 Jul 15;72(14):3631-41. | ||||
REF 8 | microRNA-103 regulates the growth and invasion of endometrial cancer cells through the downregulation of tissue inhibitor of metalloproteinase 3. Oncol Lett. 2012 Jun;3(6):1221-1226. | ||||
REF 9 | miR-103 promotes 3T3-L1 cell adipogenesis through AKT/mTOR signal pathway with its target being MEF2D.Biol Chem. 2015 Mar;396(3):235-44. | ||||
REF 10 | miR-103 regulates triple negative breast cancer cells migration and invasion through targeting olfactomedin 4.Biomed Pharmacother. 2017 May;89:1401-1408. | ||||
REF 11 | MiR-103a targeting Piezo1 is involved in acute myocardial infarction through regulating endothelium function.Cardiol J. 2016;23(5):556-562. | ||||
REF 12 | Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67. | ||||
REF 13 | MiR-103a-3p targets the 5' UTR of GPRC5A in pancreatic cells.RNA. 2014 Sep;20(9):1431-9. | ||||
REF 14 | miR-103 inhibits proliferation and sensitizes hemopoietic tumor cells for glucocorticoid-induced apoptosis. Oncotarget. 2017 Jan 3;8(1):472-489. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.