Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T99948 Target Info
Target Name Programmed cell death 1 ligand 1 (PD-L1)
Synonyms hPD-L1; Programmed death ligand 1; PDL1; PDCD1LG1; PDCD1L1; PDCD1 ligand 1; B7H1; B7-H1; B7 homolog 1
Target Type Successful Target
Gene Name CD274
Biochemical Class Immunoglobulin
UniProt ID
Q9NZQ7
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism miR-152 directly bind to B7-H1 3'UTR and inhibited B7-H1 expression. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism miR-200b targeted B7-H1 mRNA and suppressed B7-H1 expression in gastric cancer cells. [4]
Evidence Score (E-score) 2 +
1 Dual Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a directly targets PD-L1 3'UTR. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Regulation Mechanism miR-34b-5p targets B7-H3. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-570-3p miRNA Info
miRNA Mature AC
MIMAT0003235
Sequence cgaaaacagcaauuaccuuugc
miRNA Species Homo sapiens
Regulation Mechanism SNP might be responsible for aberrrant CD274 protein expression in gastric cancer by distrrupting the interaction between miR-570 and CD274 mRNA. [9]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR [8]
2 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-593-3p miRNA Info
miRNA Mature AC
MIMAT0004802
Sequence ugucucugcugggguuucu
miRNA Species Homo sapiens
Regulation Mechanism B7-H3 is a direct target for miR-593. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 qPCR [10]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism miR-214-3p targets B7-H3. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29c targets B7-H3. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-324-5p miRNA Info
miRNA Mature AC
MIMAT0000761
Sequence cgcauccccuagggcauuggug
miRNA Species Homo sapiens
Regulation Mechanism miR-324-5p targets PD-L1. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Regulation Mechanism miR-326 targets B7-H3. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-338-5p miRNA Info
miRNA Mature AC
MIMAT0004701
Sequence aacaauauccuggugcugagug
miRNA Species Homo sapiens
Regulation Mechanism miR-338-5p targets PD-L1. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA LDL receptor related protein-1 (LRP-1) Target Info
LRP1_HUMAN
Lysophosphatidic acid receptor 1 (LPAR1) Target Info
LPAR1_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism miR-708-5p targets B7-H3. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-152-5p miRNA Info
miRNA Mature AC
MIMAT0026479
Sequence agguucugugauacacuccgacu
miRNA Species Homo sapiens
Regulation Mechanism miR-152 targeted B7-H1 mRNA and suppressed B7-H1 expression. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-665 miRNA Info
miRNA Mature AC
MIMAT0004952
Sequence accaggaggcugaggccccu
miRNA Species Homo sapiens
Regulation Mechanism miR-665 targets B7-H3. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Cannabinoid receptor 2 (CB2) Target Info
CNR2_HUMAN
Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-940 miRNA Info
miRNA Mature AC
MIMAT0004983
Sequence aaggcagggcccccgcucccc
miRNA Species Homo sapiens
Regulation Mechanism miR-940 targets B7-H3. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Dual specificity protein phosphatase 1 (DUSP1) Target Info
DUS1_HUMAN
Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-363-5p miRNA Info
miRNA Mature AC
MIMAT0003385
Sequence cggguggaucacgaugcaauuu
miRNA Species Homo sapiens
Regulation Mechanism miR-363-5p targets B7-H3. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-380-5p miRNA Info
miRNA Mature AC
MIMAT0000734
Sequence ugguugaccauagaacaugcgc
miRNA Species Homo sapiens
Regulation Mechanism B7-H3 is a direct target for miR-380-5p. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-513a-5p miRNA Info
miRNA Mature AC
MIMAT0002877
Sequence uucacagggaggugucau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-601 miRNA Info
miRNA Mature AC
MIMAT0003269
Sequence uggucuaggauuguuggaggag
miRNA Species Homo sapiens
Regulation Mechanism B7-H3 is a direct target for miR-601. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
miRNA Mature ID hsa-miR-885-3p miRNA Info
miRNA Mature AC
MIMAT0004948
Sequence aggcagcgggguguaguggaua
miRNA Species Homo sapiens
Regulation Mechanism B7-H3 is a direct target for miR-885-3p. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
References  Top
REF 1 MicroRNA-152 regulates immune response via targeting B7-H1 in gastric carcinoma. Oncotarget. 2017 Apr 25;8(17):28125-28134.
REF 2 The Roles of microRNAs in Regulating the Expression of PD-1/PD-L1 Immune Checkpoint. Int J Mol Sci. 2017 Nov 27;18(12). pii: E2540.
REF 3 Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 2014 Oct 28;5:5241.
REF 4 Helicobacter Pylori Promote B7-H1 Expression by Suppressing miR-152 and miR-200b in Gastric Cancer Cells. PLoS One. 2017 Jan 5;12(1):e0168822.
REF 5 Tumor suppressor miR-34a targets PD-L1 and functions as a potential immunotherapeutic target in acute myeloid leukemia. Cell Signal. 2015 Mar;27(3):443-52.
REF 6 PDL1 Regulation by p53 via miR-34. J Natl Cancer Inst. 2015 Nov 17;108(1). pii: djv303.
REF 7 Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80.
REF 8 A frequent somatic mutation in CD274 3'-UTR leads to protein over-expression in gastric cancer by disrupting miR-570 binding. Hum Mutat. 2012 Mar;33(3):480-4.
REF 9 A miR-570 binding site polymorphism in the B7-H1 gene is associated with the risk of gastric adenocarcinoma. Hum Genet. 2013 Jun;132(6):641-8.
REF 10 B7H3 As a Promoter of Metastasis and Promising Therapeutic Target. Front Oncol. 2018 Jul 6;8:264.
REF 11 Mycobacteria-responsive sonic hedgehog signaling mediates programmed death-ligand 1- and prostaglandin E2-induced regulatory T cell expansion. Sci Rep. 2016 Apr 15;6:24193.
REF 12 MicroRNA-513 regulates B7-H1 translation and is involved in IFN-gamma-induced B7-H1 expression in cholangiocytes. J Immunol. 2009 Feb 1;182(3):1325-33.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.