miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-885-3p | ||||
| miRNA Stemloop AC | MI0005560 | ||||
| miRNA Stemloop ID | hsa-mir-885 | ||||
| Sequence | aggcagcgggguguaguggaua | ||||
| TTD Target(s) Regulated by This miRNA | Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Bone morphogenetic protein receptor type-1A | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80. | ||||
| REF 2 | MicroRNA-885-3p inhibits the growth of HT-29 colon cancer cell xenografts by disrupting angiogenesis via targeting BMPR1A and blocking BMP/Smad/Id1 signaling.Oncogene. 2015 Apr 9;34(15):1968-78. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.