miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-940 | ||||
| miRNA Stemloop AC | MI0005762 | ||||
| miRNA Stemloop ID | hsa-mir-940 | ||||
| Sequence | aaggcagggcccccgcucccc | ||||
| TTD Target(s) Regulated by This miRNA | Programmed cell death 1 ligand 1 (PD-L1) | Successful Target | Target Info | [1] | |
| Dual specificity protein phosphatase 1 (DUSP1) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Zinc finger protein 24 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Identifying microRNAs regulating B7-H3 in breast cancer: the clinical impact of microRNA-29c. Br J Cancer. 2014 Apr 15;110(8):2072-80. | ||||
| REF 2 | Retaining MKP1 expression and attenuating JNK-mediated apoptosis by RIP1 for cisplatin resistance through miR-940 inhibition. Oncotarget. 2014 Mar 15;5(5):1304-14. | ||||
| REF 3 | MicroRNA-940 promotes tumor cell invasion and metastasis by downregulating ZNF24 in gastric cancer.Oncotarget. 2015 Sep 22;6(28):25418-28. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.