Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T44479 Target Info
Target Name Gap junction alpha-1 protein (GJA1)
Synonyms Gap junction 43 kDa heart protein; GJAL; Cx43; Connexin-43; Connexin 43
Target Type Clinical trial Target
Gene Name GJA1
Biochemical Class Gap junction-forming connexin
UniProt ID
P17302
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism GJA is the target gene of miR-222 and is negatively regulated by overexpression of miR-222. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 Luciferase Reporter Assay; Western Blot; Immunofluorescence [4]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism Cx43 mRNA can be suppressed by miR-23a using a luciferase reporter assay. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-23a-5p miRNA Info
miRNA Mature AC
MIMAT0004496
Sequence gggguuccuggggaugggauuu
miRNA Species Homo sapiens
Regulation Mechanism GJA1 was identified as the target gene of miR-23a by luciferase assay and miRNA-masking antisense ODN (miR-Mask) assay. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Gap junction alpha-1 protein (GJA1) Target Info
CXA1_HUMAN
Lysosome-associated membrane glycoprotein 1 (CD107a) Target Info
LAMP1_HUMAN
miRNA Mature ID hsa-miR-1-3p miRNA Info
miRNA Mature AC
MIMAT0000416
Sequence uggaauguaaagaaguauguau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-186-5p miRNA Info
miRNA Mature AC
MIMAT0000456
Sequence caaagaauucuccuuuugggcu
miRNA Species Homo sapiens
Regulation Mechanism miR-186 notably suppressed the mRNA levels of human Cx43. [6]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism miR-200a dramatically suppressed Cx43 expression activity. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Inhibition of miR-20a resulted in about 4-fold increase in CX43 protein level. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism GJA is the target gene of miR-221 and is negatively regulated by overexpression of miR-221. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Immunofluorescence [4]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism The protein level of Cx43 was significantly inhibited by the treatment of aforementioned miR-23b. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-381-3p miRNA Info
miRNA Mature AC
MIMAT0000736
Sequence uauacaagggcaagcucucugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Calcium-dependent chloride channel anoctamin (ANO) Target Info
ANO1_HUMAN
Gap junction alpha-1 protein (GJA1) Target Info
CXA1_HUMAN
miRNA Mature ID hsa-miR-1298-5p miRNA Info
miRNA Mature AC
MIMAT0005800
Sequence uucauucggcuguccagaugua
miRNA Species Homo sapiens
Regulation Mechanism Cx43 is a direct target of miR-1298 and was involved in miR-1298-induced cellular effects. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Gap junction alpha-1 protein (GJA1) Target Info
CXA1_HUMAN
References  Top
REF 1 Myocardin inhibited the gap protein connexin 43 via promoted miR-206 to regulate vascular smooth muscle cell phenotypic switch. Gene. 2017 Jun 15;616:22-30.
REF 2 MIR-206 regulates connexin43 expression during skeletal muscle development. Nucleic Acids Res. 2006;34(20):5863-71.
REF 3 Genistein Improves the Major Depression through Suppressing the Expression of miR-221/222 by Targeting Connexin 43. Psychiatry Investig. 2018 Oct;15(10):919-925.
REF 4 miR-221/222 is the regulator of Cx43 expression in human glioblastoma cells. Oncol Rep. 2012 May;27(5):1504-10.
REF 5 miR-23a impairs bone differentiation in osteosarcoma via down-regulation of GJA1. Front Genet. 2015 Jul 2;6:233.
REF 6 Identification of miR-200a as a novel suppressor of connexin 43 in breast cancer cells. Biosci Rep. 2015 Aug 17;35(5). pii: e00251.
REF 7 MicroRNA-23a participates in estrogen deficiency induced gap junction remodeling of rats by targeting GJA1. Int J Biol Sci. 2015 Feb 15;11(4):390-403.
REF 8 Downregulation of connexin43 by microRNA-130a in cardiomyocytes results in cardiac arrhythmias. J Mol Cell Cardiol. 2014 Sep;74:53-63.
REF 9 Suppression of CX43 expression by miR-20a in the progression of human prostate cancer. Cancer Biol Ther. 2012 Aug;13(10):890-8.
REF 10 MicroRNA-1298 is regulated by DNA methylation and affects vascular smooth muscle cell function by targeting connexin 43. Cardiovasc Res. 2015 Sep 1;107(4):534-45.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.