Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T40192 Target Info
Target Name DNA-binding factor KBF1 (p105)
Synonyms Nuclear factor of kappa light polypeptide gene enhancer in Bcells 1; Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1; Nuclear factor NFkappaB p50 subunit; Nuclear factor NFkappaB p105 subunit; Nuclear factor NF-kappa-B p105 subunit; EBP1; EBP-1; DNAbinding factor KBF1
Target Type Clinical trial Target
Gene Name NFKB1
UniProt ID
P19838
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Reexpression of miR-146a led to the inhibition of of NFKB1 in EGFR signaling in pancreatic cancer cells. [2]
Evidence Score (E-score) 4 +
1 ELISA; Immunoblot; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot; Flow [3]
4 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism NF-kappa B p65 was identified as a target of miR-155-5p. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 Proteomics [6]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-139-5p miRNA Info
miRNA Mature AC
MIMAT0000250
Sequence ucuacagugcacgugucuccagu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [8]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-9-5p miRNA Info
miRNA Mature AC
MIMAT0000441
Sequence ucuuugguuaucuagcuguauga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-9-5p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target NFKB1. [8]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Fluorescence Intensity [8]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-339-3p miRNA Info
miRNA Mature AC
MIMAT0004702
Sequence ugagcgccucgacgacagagccg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [9]
Representative Target(s) Regulated by This miRNA DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
Forkhead box protein O1A (FOXO1) Target Info
FOXO1_HUMAN
miRNA Mature ID hsa-miR-508-3p miRNA Info
miRNA Mature AC
MIMAT0002880
Sequence ugauuguagccuuuuggaguaga
miRNA Species Homo sapiens
Regulation Mechanism NFKB1 is a direct target of miR-508-3p in GC. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Immunohistochemistry [10]
Representative Target(s) Regulated by This miRNA DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
References  Top
REF 1 Denbinobin upregulates miR-146a expression and attenuates IL-1-induced upregulation of ICAM-1 and VCAM-1 expressions in osteoarthritis fibroblast-like synoviocytes. J Mol Med (Berl). 2014 Nov;92(11):1147-58.
REF 2 Expression of microRNA-146 suppresses NF-kappaB activity with reduction of metastatic potential in breast cancer cells. Oncogene. 2008 Sep 18;27(42):5643-7.
REF 3 Celastrol induces apoptosis of gastric cancer cells by miR-146a inhibition of NF-B activity. Cancer Cell Int. 2013 May 27;13(1):50.
REF 4 miR-146a suppresses invasion of pancreatic cancer cells. Cancer Res. 2010 Feb 15;70(4):1486-95.
REF 5 miR-155-5p inhibition promotes the transition of bone marrow mesenchymal stem cells to gastric cancer tissue derived MSC-like cells via NF-B p65 activation. Oncotarget. 2016 Mar 29;7(13):16567-80.
REF 6 MicroRNA-155 silencing enhances inflammatory response and lipid uptake in oxidized low-density lipoprotein-stimulated human THP-1 macrophages. J Investig Med. 2010 Dec;58(8):961-7.
REF 7 miR-139-5p is a regulator of metastatic pathways in breast cancer. RNA. 2013 Dec;19(12):1767-80.
REF 8 MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene. 2007 Jun 14;26(28):4148-57.
REF 9 Acupuncture may exert its therapeutic effect through microRNA-339/Sirt2/NFB/FOXO1 axis. Biomed Res Int. 2015;2015:249013.
REF 10 miR-508-3p concordantly silences NFKB1 and RELA to inactivate canonical NF-B signaling in gastric carcinogenesis. Mol Cancer. 2016 Jan 22;15:9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.