miRNA General Information
miRNA Mature ID	hsa-miR-339-3p
miRNA Stemloop AC	MI0000815
miRNA Stemloop ID	hsa-mir-339
Sequence	ugagcgccucgacgacagagccg
TTD Target(s) Regulated by This miRNA	Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1)	Clinical trial Target	Target Info	[1]
	DNA-binding factor KBF1 (p105)	Clinical trial Target	Target Info	[2]
	Forkhead box protein O1A (FOXO1)	Literature-reported Target	Target Info	[2]
References
REF 1	miR-339-3p Is a Tumor Suppressor in Melanoma. Cancer Res. 2016 Jun 15;76(12):3562-71.
REF 2	Acupuncture may exert its therapeutic effect through microRNA-339/Sirt2/NFB/FOXO1 axis. Biomed Res Int. 2015;2015:249013.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.