miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-508-3p | ||||
| miRNA Stemloop AC | MI0003195 | ||||
| miRNA Stemloop ID | hsa-mir-508 | ||||
| Sequence | ugauuguagccuuuuggaguaga | ||||
| TTD Target(s) Regulated by This miRNA | DNA-binding factor KBF1 (p105) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | 1-phosphatidylinositol 3-phosphate 5-kinase | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR-508-3p concordantly silences NFKB1 and RELA to inactivate canonical NF-B signaling in gastric carcinogenesis. Mol Cancer. 2016 Jan 22;15:9. | ||||
| REF 2 | A MicroRNA Signature in Gestational Diabetes Mellitus Associated with Risk of Macrosomia.Cell Physiol Biochem. 2015;37(1):243-52. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.