Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T26457 Target Info
Target Name Integrin beta-3 (ITGB3)
Synonyms GPIIIa; GP3A; CD61
Target Type Literature-reported Target
Gene Name ITGB3
Biochemical Class Integrin
UniProt ID
P05106
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7a-5p miRNA Info
miRNA Mature AC
MIMAT0000062
Sequence ugagguaguagguuguauaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
GTPase HRas (HRAS) Target Info
RASH_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism The 3'UTR of ITGB3 contains let-7c binding sites. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-17-3p miRNA Info
miRNA Mature AC
MIMAT0000071
Sequence acugcagugaaggcacuuguag
miRNA Species Homo sapiens
Regulation Mechanism miR-17 bound directly to the 3'UTR of ITGB3 and suppressed its expression. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA E-selectin (SELE) Target Info
LYAM2_HUMAN
Integrin alpha-5 (ITGA5) Target Info
ITA5_HUMAN
miRNA Mature ID hsa-miR-192-5p miRNA Info
miRNA Mature AC
MIMAT0000222
Sequence cugaccuaugaauugacagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-192 decreased cellular anchoring via the repression of ITGB3 by binding its UTR. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism Bioinformatic algorithms and luciferase reporter assays revealed that ITGB3 is a direct target of miR-30a- 5p. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Regulation Mechanism ITGB3 was a novel target gene of miR-338 by binding to ITGB3 3'UTR. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism mir-98 targets ITGB3 to inhibit proliferation, migration, and invasion of non-small-cell lung cancer. ITGB3 is a target of mir-98 and contributes to cell proliferation. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
References  Top
REF 1 Integrin beta 3 expression is regulated by let-7a miRNA in malignant melanoma. Oncogene. 2008 Nov 6;27(52):6698-706.
REF 2 MicroRNA let-7c inhibits migration and invasion of human non-small cell lung cancer by targeting ITGB3 and MAP4K3. Cancer Lett. 2014 Jan 1;342(1):43-51.
REF 3 miR-17 inhibits ovarian cancer cell peritoneal metastasis by targeting ITGA5 and ITGB1. Oncol Rep. 2016 Oct;36(4):2177-83.
REF 4 miR-192 suppresses leptomeningeal dissemination of medulloblastoma by modulating cell proliferation and anchoring through the regulation of DHFR, integrins, and CD47. Oncotarget. 2015 Dec 22;6(41):43712-30.
REF 5 MiR-30a-5p Suppresses Tumor Metastasis of Human Colorectal Cancer by Targeting ITGB3. Cell Physiol Biochem. 2016;39(3):1165-76.
REF 6 miR-338 inhibits the metastasis of lung cancer by targeting integrin 3. Oncol Rep. 2016 Sep;36(3):1467-74.
REF 7 miR-98 targets ITGB3 to inhibit proliferation, migration, and invasion of non-small-cell lung cancer. Onco Targets Ther. 2015 Sep 22;8:2689-97.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.