Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T18390 Target Info
Target Name Large tumor suppressor homolog 2 (LATS2)
Synonyms Warts-like kinase; Serine/threonine-protein kinase kpm; Serine/threonine-protein kinase LATS2; Kinase phosphorylated during mitosis protein; KPM
Target Type Literature-reported Target
Gene Name LATS2
Biochemical Class Kinase
UniProt ID
Q9NRM7
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Regulation Mechanism The mutation of miR-372-3p resulted in the increased protein level of target LATS2. [2]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot; Reporter Assay [2]
3 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
5 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Regulation Mechanism The mutation of miR-373-3p resulted in the increased protein level of target LATS2; The overexpression by mature miRNA precursor transfection resulted in the decreased protein level of target LATS2. [2]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; Western Blot [4]
2 Luciferase Reporter Assay; Western Blot [5]
3 Luciferase Reporter Assay; Western Blot [6]
4 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-135b-3p miRNA Info
miRNA Mature AC
MIMAT0004698
Sequence auguagggcuaaaagccauggg
miRNA Species Homo sapiens
Regulation Mechanism LATS2 is a target of miR-135b. [9]
Evidence Score (E-score) 3 +
1 Immunofluorescence; Western Blot [7]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
3 Microarray [9]
Representative Target(s) Regulated by This miRNA Large tumor suppressor homolog 2 (LATS2) Target Info
LATS2_HUMAN
Signal transducer and activator of transcription 6 (STAT6) Target Info
STAT6_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-31-5p by mature miRNA precursor transfection resulted in the changed mRNA level of target LATS2. [2]
Evidence Score (E-score) 2 +
1 qRT-PCR; Luciferase Reporter Assay [10]
2 qRT-PCR; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miR-107 plays an important role in proliferation and invasion of the gastric cancer cells by targeting LATS2 to form the miR-LATS2 axis. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism miR-181c directly targets LATS2. [12]
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism miR-25 plays an important role in proliferation and invasion of the gastric cancer cells by targeting LATS2 to form the miR-LATS2 axis. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-93 functions as an oncogene by enhancing tumor cell survival, blood vessel formation and tumor metastasis by targeting LATS2. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
References  Top
REF 1 RNA-binding protein Dnd1 inhibits microRNA access to target mRNA. Cell. 2007 Dec 28;131(7):1273-86.
REF 2 A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell. 2006 Mar 24;124(6):1169-81.
REF 3 miR-372 regulates cell cycle and apoptosis of ags human gastric cancer cell line through direct regulation of LATS2. Mol Cells. 2009 Dec 31;28(6):521-7.
REF 4 Helicobacter pylori interferes with an embryonic stem cell micro RNA cluster to block cell cycle progression. Silence. 2011 Oct 25;2(1):7.
REF 5 MicroRNA control of signal transduction. Nat Rev Mol Cell Biol. 2010 Apr;11(4):252-63.
REF 6 MicroRNA-373 (miR-373) post-transcriptionally regulates large tumor suppressor, homolog 2 (LATS2) and stimulates proliferation in human esophageal cancer. Exp Cell Res. 2009 Sep 10;315(15):2529-38.
REF 7 MicroRNA-135b regulates apoptosis and chemoresistance in colorectal cancer by targeting large tumor suppressor kinase 2. Am J Cancer Res. 2015 Mar 15;5(4):1382-95.
REF 8 miR-135b, upregulated in breast cancer, promotes cell growth and disrupts the cell cycle by regulating LATS2. Int J Oncol. 2016 May;48(5):1997-2006.
REF 9 Specific alterations of the microRNA transcriptome and global network structure in colorectal cancer after treatment with MAPK/ERK inhibitors. J Mol Med (Berl). 2012 Dec;90(12):1421-38.
REF 10 MicroRNA-31 functions as an oncogenic microRNA in mouse and human lung cancer cells by repressing specific tumor suppressors. J Clin Invest. 2010 Apr;120(4):1298-309.
REF 11 miR-107 and miR-25 simultaneously target LATS2 and regulate proliferation and invasion of gastric adenocarcinoma (GAC) cells. Biochem Biophys Res Commun. 2015 May 8;460(3):806-12.
REF 12 Upregulation of miR-181c contributes to chemoresistance in pancreatic cancer by inactivating the Hippo signaling pathway. Oncotarget. 2015 Dec 29;6(42):44466-79.
REF 13 MiR-93 enhances angiogenesis and metastasis by targeting LATS2. Cell Cycle. 2012 Dec 1;11(23):4352-65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.