Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T92477 | Target Info | |||
| Target Name | Suppressor of cytokine signaling 3 (SOCS3) | ||||
| Synonyms | STAT-induced STAT inhibitor 3; STAT induced STAT inhibitor 3; SSI3; SSI-3; SOCS-3; Cytokine-inducible SH2 protein 3; CIS3; CIS-3 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | SOCS3 | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-203a-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | gugaaauguuuaggaccacuag | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 3 | + | |||
| 1 | ELISA; qRT-PCR | [1] | |||
| 2 | ELISA; qRT-PCR | [2] | |||
| 3 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [3] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis inhibitor survivin (BIRC5) | Target Info | |||
| Apoptosis regulator Bcl-W (BCL-W) | Target Info | ||||
| miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uuaaugcuaaucgugauagggguu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [4] | |||
| 2 | qRT-PCR | [5] | |||
| Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
| Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-19a-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugugcaaaucuaugcaaaacuga | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | HITS-CLIP | [6] | |||
| 2 | Luciferase Reporter Assay | [7] | |||
| Representative Target(s) Regulated by This miRNA | Adrenergic receptor beta-1 (ADRB1) | Target Info | |||
| Apoptosis signal-regulating kinase 1 (MAP3K5) | Target Info | ||||
| miRNA Mature ID | hsa-miR-221-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | agcuacauugucugcuggguuuc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | SOCS3 3'UTR was significantly suppressed by miR-221 mimic. | [9] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [8] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [9] | |||
| Representative Target(s) Regulated by This miRNA | Bcl-2-binding component 3 (BBC3) | Target Info | |||
| Beclin-1 (BECN1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-455-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uaugugccuuuggacuacaucg | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [10] | |||
| 2 | qRT-PCR | [11] | |||
| Representative Target(s) Regulated by This miRNA | Ribosomal protein S6 kinase beta-1 (S6K1) | Target Info | |||
| Suppressor of cytokine signaling 3 (SOCS3) | Target Info | ||||
| miRNA Mature ID | hsa-miR-15b-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uagcagcacaucaugguuuaca | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Overexpression of miR-15b significantly reduced the levels of SOCS3 in hyperglycemia. | [12] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | qRT-PCR; Western Blot | [12] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Checkpoint kinase-1 (CHK1) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Identifying targets for topical RNAi therapeutics in psoriasis: assessment of a new in vitro psoriasis model. Arch Dermatol Res. 2013 Aug;305(6):501-12. | ||||
| REF 2 | MicroRNAs: novel regulators involved in the pathogenesis of psoriasis PLoS One. 2007 Jul 11;2(7):e610. | ||||
| REF 3 | Anti-miR-203 Upregulates SOCS3 Expression in Breast Cancer Cells and Enhances Cisplatin Chemosensitivity. Genes Cancer. 2011 Jul;2(7):720-7. | ||||
| REF 4 | MiR-155 regulates the proliferation and apoptosis of pancreatic cancer cells through targeting SOCS3. Eur Rev Med Pharmacol Sci. 2019 Jun;23(12):5168-5175. | ||||
| REF 5 | Borna disease virus encoded phosphoprotein inhibits host innate immunity by regulating miR-155. Antiviral Res. 2013 Apr;98(1):66-75. | ||||
| REF 6 | EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21. | ||||
| REF 7 | miR-19a: an effective regulator of SOCS3 and enhancer of JAK-STAT signalling. PLoS One. 2013 Jul 22;8(7):e69090. | ||||
| REF 8 | Silencing microRNA-221/222 cluster suppresses glioblastoma angiogenesis by suppressor of cytokine signaling-3-dependent JAK/STAT pathway. J Cell Physiol. 2019 Dec;234(12):22272-22284. | ||||
| REF 9 | MiR-221 accentuates IFNs anti-HCV effect by downregulating SOCS1 and SOCS3. Virology. 2014 Aug;462-463:343-50. | ||||
| REF 10 | Pentagalloylglucose Inhibits the Replication of Rabies Virus via Mediation of the miR-455/SOCS3/STAT3/IL-6 Pathway. J Virol. 2019 Aug 28;93(18). pii: e00539-19. | ||||
| REF 11 | Serum microRNA profiling and bioinformatics analysis of patients with type 2 diabetes mellitus in a Chinese population. Mol Med Rep. 2017 Apr;15(4):2143-2153. | ||||
| REF 12 | miR-15b/16 protects primary human retinal microvascular endothelial cells against hyperglycemia-induced increases in tumor necrosis factor alpha and suppressor of cytokine signaling 3. J Neuroinflammation. 2015 Mar 4;12:44. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.