Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T71266 Target Info
Target Name RAC-gamma serine/threonine-protein kinase (AKT3)
Synonyms STK-2; RAC-PK-gamma; Protein kinase B gamma; Protein kinase Akt-3; PKBG; PKB gamma
Target Type Successful Target
Gene Name AKT3
Biochemical Class Kinase
UniProt ID
Q9Y243
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [1]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 PAR-CLIP [4]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 PAR-CLIP [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29b directly targets and thus negatively regulates AKT3. [6]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [6]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miRNA- 29c exerts its growth inhibitory effects through direct binding and regulation of V-Akt murine thymoma viral oncogene homolog 3 (AKT3). [9]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [8]
2 Sequencing [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-20b mimic reduced the relative luciferase activity of the reporter containing the wild-type 3'TR, while miR-20b inhibitor significantly increased the relative luciferase activity of the reporter containing the wild-type 3'TR suggesting that AKT3 is a target of miR-20b. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-29b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004514
Sequence gcugguuucauauggugguuuaga
miRNA Species Homo sapiens
Regulation Mechanism Protein expression of AKT3 was downregulated by miR-29b. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Janus kinase 3 (JAK-3) Target Info
JAK3_HUMAN
Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
miRNA Mature ID hsa-miR-519d-3p miRNA Info
miRNA Mature AC
MIMAT0002853
Sequence caaagugccucccuuuagagug
miRNA Species Homo sapiens
Regulation Mechanism miR-519d targets AKT3. [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [12]
Representative Target(s) Regulated by This miRNA Calcium-release activated calcium channel (CRACM) Target Info
CRCM1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
References  Top
REF 1 miR-122 regulates tumorigenesis in hepatocellular carcinoma by targeting AKT3. PLoS One. 2013 Nov 7;8(11):e79655.
REF 2 MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
REF 3 MicroRNA-15a and microRNA-16 impair human circulating proangiogenic cell functions and are increased in the proangiogenic cells and serum of patients with critical limb ischemia. Circ Res. 2013 Jan 18;112(2):335-46.
REF 4 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 5 MiR-15b-5p Regulates Collateral Artery Formation by Targeting AKT3 (Protein Kinase B-3). Arterioscler Thromb Vasc Biol. 2017 May;37(5):957-968.
REF 6 MicroRNA-29B (mir-29b) regulates the Warburg effect in ovarian cancer by targeting AKT2 and AKT3. Oncotarget. 2015 Dec 1;6(38):40799-814.
REF 7 miR-29a suppresses growth and metastasis in papillary thyroid carcinoma by targeting AKT3. Tumour Biol. 2016 Mar;37(3):3987-96.
REF 8 Regulation of miRNA-29c and its downstream pathways in preneoplastic progression of triple-negative breast cancer. Oncotarget. 2017 Mar 21;8(12):19645-19660.
REF 9 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 10 MiR-20b targets AKT3 and modulates vascular endothelial growth factor-mediated changes in diabetic retinopathy. Acta Biochim Biophys Sin (Shanghai). 2016 Aug;48(8):732-40.
REF 11 MiRNA-29b suppresses tumor growth through simultaneously inhibiting angiogenesis and tumorigenesis by targeting Akt3. Cancer Lett. 2017 Jul 1;397:111-119.
REF 12 In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.