Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35486 Target Info
Target Name GTPase NRas (NRAS)
Synonyms Transforming protein N-Ras; HRAS1
Target Type Clinical trial Target
Gene Name NRAS
Biochemical Class Small GTPase
UniProt ID
P01111
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 exhibited inhibitory role in tumor angiogenesis, cell growth and invasion and tumor growth through the post-transcriptional regulation of the targets N-RAS. [1]
Evidence Score (E-score) 3 +
1 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay; Northern Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism Immunohistochemistries shows protein expression of the let-7 targets N-RAS and CDC25A. [6]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; qRT-PCR [4]
2 Luciferase Reporter Assay [5]
3 Proteomics [6]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting NRAS. [7]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [7]
2 Western Blot [8]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunofluorescence; qRT-PCR; Western Blot [9]
2 Microarray [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-let-7a-5p miRNA Info
miRNA Mature AC
MIMAT0000062
Sequence ugagguaguagguuguauaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
GTPase HRas (HRAS) Target Info
RASH_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Northern Blot; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-20a targets gene of N-Ras. [12]
Evidence Score (E-score) 1 +
1 Western Blot [12]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism miR-214 overexpression can inhibits NRAS by binding to 3'UTR of NRAS. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [13]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-98-3p miRNA Info
miRNA Mature AC
MIMAT0022842
Sequence cuauacaacuuacuacuuuccc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA GTPase NRas (NRAS) Target Info
RASN_HUMAN
References  Top
REF 1 MiR-145 inhibits tumor angiogenesis and growth by N-RAS and VEGF. Cell Cycle. 2012 Jun 1;11(11):2137-45.
REF 2 Effects of miR-145-5p through NRAS on the cell proliferation, apoptosis, migration, and invasion in melanoma by inhibiting MAPK and PI3K/AKT pathways. Cancer Med. 2017 Apr;6(4):819-833.
REF 3 Downregulation of miR-145 associated with cancer progression and VEGF transcriptional activation by targeting N-RAS and IRS1. Biochim Biophys Acta. 2013 Feb;1829(2):239-47.
REF 4 Regression of murine lung tumors by the let-7 microRNA. Oncogene. 2010 Mar 18;29(11):1580-7.
REF 5 The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22.
REF 6 Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
REF 7 miR148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5, ROCK1, PIK3CA, NRAS, and CSF1. FASEB J. 2013 Mar;27(3):1223-35.
REF 8 Down-regulation of miR-21 biogenesis by estrogen action contributes to osteoclastic apoptosis. J Cell Biochem. 2013 Jun;114(6):1217-22.
REF 9 CCL18-mediated down-regulation of miR98 and miR27b promotes breast cancer metastasis. Oncotarget. 2015 Aug 21;6(24):20485-99.
REF 10 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
REF 11 RAS is regulated by the let-7 microRNA family. Cell. 2005 Mar 11;120(5):635-47.
REF 12 MicroRNA regulation of Alzheimer's Amyloid precursor protein expression. Neurobiol Dis. 2009 Mar;33(3):422-8.
REF 13 MiR-214 and N-ras regulatory loop suppresses rhabdomyosarcoma cell growth and xenograft tumorigenesis. Oncotarget. 2014 Apr 30;5(8):2161-75.
REF 14 miR-98 functions as a tumor suppressor in salivary adenoid cystic carcinomas. Onco Targets Ther. 2016 Mar 23;9:1777-86.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.