miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-98-3p | ||||
| miRNA Stemloop AC | MI0000100 | ||||
| miRNA Stemloop ID | hsa-mir-98 | ||||
| Sequence | cuauacaacuuacuacuuuccc | ||||
| TTD Target(s) Regulated by This miRNA | GTPase NRas (NRAS) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Transcription factor E2F5 | Regulated Protein | [2] | ||
| Twist-related protein 1 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | miR-98 functions as a tumor suppressor in salivary adenoid cystic carcinomas. Onco Targets Ther. 2016 Mar 23;9:1777-86. | ||||
| REF 2 | SNHG16 contributes to breast cancer cell migration by competitively binding miR-98 with E2F5.Biochem Biophys Res Commun. 2017 Apr 1;485(2):272-278. | ||||
| REF 3 | miR-98 inhibits expression of TWIST to prevent progression of non-small cell lung cancers.Biomed Pharmacother. 2017 May;89:1453-1461. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.