The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-106b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcugacagugcagau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Microarray |
[1] |
2 |
Western Blot; Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-142-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaguguuuccuacuuuaugga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Microarray |
[3] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
High mobility group protein B1 (HMGB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
PCAF is a target for miR-17-5p in cultured PCa cells. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-19a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugugcaaaucuaugcaaaacuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot; Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Adrenergic receptor beta-1 (ADRB1)
|
Target Info
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-25-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cauugcacuugucucggucuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-25 cluster interact with the PCAF 3 UTR in vitro. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot; Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-32-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uauugcacauuacuaaguugca
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-32 interacts with the PCAF 3 UTR in vitro. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot; Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Aurora kinase A (AURKA)
|
Target Info
|
|
F-box and WD-40 domain protein 7 (Fbxw7)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-93-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuguucgugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot; Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Angiogenin (ANG)
|
Target Info
|
|
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|