Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T94621 Target Info
Target Name RAC-beta serine/threonine-protein kinase (AKT2)
Synonyms RAC-PK-beta; Protein kinase B beta; Protein kinase Akt-2; PKB beta
Target Type Literature-reported Target
Gene Name AKT2
Biochemical Class Kinase
UniProt ID
P31751
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Expression of all the miR-29 family members is markedly downregulated in AML patients AKT2. [3]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-184 miRNA Info
miRNA Mature AC
MIMAT0000454
Sequence uggacggagaacugauaagggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-184 by mature miRNA mimics tranfection resulted in the decreased protein level of target AKT2. [5]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR [4]
2 Luciferase Reporter Assay; qRT-PCR [5]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Platelet-derived growth factor B (PDGFB) Target Info
PDGFB_HUMAN
miRNA Mature ID hsa-miR-612 miRNA Info
miRNA Mature AC
MIMAT0003280
Sequence gcugggcagggcuucugagcuccuu
miRNA Species Homo sapiens
Regulation Mechanism AKT2 was verified to be one of the direct targets of miR-612. [8]
Evidence Score (E-score) 3 +
1 Immunofluorescence; Luciferase Reporter Assay; Western Blot [7]
2 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [8]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
RAC-beta serine/threonine-protein kinase (AKT2) Target Info
AKT2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Regulation Mechanism miR-143-3p acts as a novel tumor suppressive miRNA by regulating tumor growth, migration and invasion through directly targeting AKT2. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [10]
2 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [12]
2 Northern Blot; Western Blot [13]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7b inhibited AKT2 expression by directly binding to its 3'UTR, reduced p-AKT (S473) activation and suppressed expression of the downstream effector Ps6. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Regulation Mechanism Let-7g inhibited AKT2 expression by directly binding to its 3'UTR, reduced p-AKT (S473) activation and suppressed expression of the downstream effector Ps6. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29s could exerted its regulating role in gastric cancer through the crucial AKT2 pathway. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Regulation Mechanism miR-302b specifically binds to the seed sequence at the 3'UTR of AKT2. [15]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism AKT2 is also a functional target of miR-708 in prostate cancer. [16]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [16]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-148a-5p miRNA Info
miRNA Mature AC
MIMAT0004549
Sequence aaaguucugagacacuccgacu
miRNA Species Homo sapiens
Regulation Mechanism AKT2 was a direct target of miR-148a. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-2861 miRNA Info
miRNA Mature AC
MIMAT0013802
Sequence ggggccuggcggugggcgg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
References  Top
REF 1 MicroRNA-29B (mir-29b) regulates the Warburg effect in ovarian cancer by targeting AKT2 and AKT3. Oncotarget. 2015 Dec 1;6(38):40799-814.
REF 2 MicroRNA-29s could target AKT2 to inhibit gastric cancer cells invasion ability. Med Oncol. 2015 Jan;32(1):342.
REF 3 The role, mechanism and potentially therapeutic application of microRNA-29 family in acute myeloid leukemia. Cell Death Differ. 2014 Jan;21(1):100-12.
REF 4 MicroRNA-184 promotes differentiation of the retinal pigment epithelium by targeting the AKT2/mTOR signaling pathway. Oncotarget. 2016 Aug 9;7(32):52340-52353.
REF 5 Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55.
REF 6 MicroRNA-184 inhibits neuroblastoma cell survival through targeting the serine/threonine kinase AKT2. Mol Cancer. 2010 Apr 21;9:83.
REF 7 MiR-612 suppresses the stemness of liver cancer via Wnt/-catenin signaling. Biochem Biophys Res Commun. 2014 Apr 25;447(1):210-5.
REF 8 miR-612 suppresses the invasive-metastatic cascade in hepatocellular carcinoma. J Exp Med. 2013 Apr 8;210(4):789-803.
REF 9 miR-612 negatively regulates colorectal cancer growth and metastasis by targeting AKT2. Cell Death Dis. 2015 Jul 9;6:e1808.
REF 10 MiR-200c regulates tumor growth and chemosensitivity to cisplatin in osteosarcoma by targeting AKT2. Sci Rep. 2017 Oct 19;7(1):13598.
REF 11 MicroRNA-143-3p, up-regulated in H. pylori-positive gastric cancer, suppresses tumor growth, migration and invasion by directly targeting AKT2. Oncotarget. 2017 Apr 25;8(17):28711-28724.
REF 12 Curcumin modulates microRNA-203-mediated regulation of the Src-Akt axis in bladder cancer. Cancer Prev Res (Phila). 2011 Oct;4(10):1698-709.
REF 13 miR-203 reverses chemoresistance in p53-mutated colon cancer cells through downregulation of Akt2 expression. Cancer Lett. 2011 May 1;304(1):52-9.
REF 14 let-7b/g silencing activates AKT signaling to promote gastric carcinogenesis. J Transl Med. 2014 Oct 5;12:281.
REF 15 miRNA-302b suppresses human hepatocellular carcinoma by targeting AKT2. Mol Cancer Res. 2014 Feb;12(2):190-202.
REF 16 miRNA-708 control of CD44(+) prostate cancer-initiating cells. Cancer Res. 2012 Jul 15;72(14):3618-30.
REF 17 miR-148a suppresses human renal cell carcinoma malignancy by targeting AKT2. Oncol Rep. 2017 Jan;37(1):147-154.
REF 18 miR-2861 acts as a tumor suppressor via targeting EGFR/AKT2/CCND1 pathway in cervical cancer induced by human papillomavirus virus 16 E6. Sci Rep. 2016 Jul 1;6:28968.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.