Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T91696 Target Info
Target Name Fibronectin (FN1)
Synonyms FN; Cold-insoluble globulin; CIG
Target Type Clinical trial Target
Gene Name FN1
Biochemical Class Fibronectin protein
UniProt ID
P02751
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism FN1 serves as target of miR-200c to inhibit cell motility and anoikis resistance. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Regulation Mechanism FN1 is targeted by let-7g to regulate mammary carcinoma cell migration and invasion. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism This confirms the direct targeting of FN mRNA by miRNA-200b binding to the 3'UTR region. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-140-3p miRNA Info
miRNA Mature AC
MIMAT0004597
Sequence uaccacaggguagaaccacgg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Cyclic ADP-ribose hydrolase 1 (CD38) Target Info
CD38_HUMAN
Fibronectin (FN1) Target Info
FINC_HUMAN
References  Top
REF 1 MicroRNA-200c binding to FN1 suppresses the proliferation, migration and invasion of gastric cancer cells. Biomed Pharmacother. 2017 Apr;88:285-292.
REF 2 Targets of miR-200c mediate suppression of cell motility and anoikis resistance. Breast Cancer Res. 2011 Apr 18;13(2):R45.
REF 3 Pivotal role of reduced let-7g expression in breast cancer invasion and metastasis. Cancer Res. 2011 Oct 15;71(20):6463-74.
REF 4 MiRNA-200b represses transforming growth factor-1-induced EMT and fibronectin expression in kidney proximal tubular cells. Am J Physiol Renal Physiol. 2013 May 15;304(10):F1266-73.
REF 5 Loss of miR-140 is a key risk factor for radiation-induced lung fibrosis through reprogramming fibroblasts and macrophages. Sci Rep. 2016 Dec 20;6:39572.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.