miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-140-3p | ||||
| miRNA Stemloop AC | MI0000456 | ||||
| miRNA Stemloop ID | hsa-mir-140 | ||||
| Sequence | uaccacaggguagaaccacgg | ||||
| TTD Target(s) Regulated by This miRNA | Cyclic ADP-ribose hydrolase 1 (CD38) | Successful Target | Target Info | [1] | |
| Fibronectin (FN1) | Clinical trial Target | Target Info | [2] | ||
| Integrin alpha-6 (ITGA6) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Collagen alpha-1(IV) chain | Regulated Protein | [3] | ||
| Glypican-1 | Regulated Protein | [5] | |||
| MARCKS-related protein | Regulated Protein | [3] | |||
| Nuclear receptor-interacting protein 1 | Regulated Protein | [6] | |||
| Phospholipid-transporting ATPase IA | Regulated Protein | [7] | |||
| Renin receptor | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | miR-140-3p regulation of TNF--induced CD38 expression in human airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol. 2012 Sep;303(5):L460-8. | ||||
| REF 2 | Loss of miR-140 is a key risk factor for radiation-induced lung fibrosis through reprogramming fibroblasts and macrophages. Sci Rep. 2016 Dec 20;6:39572. | ||||
| REF 3 | The highly expressed 5'isomiR of hsa-miR-140-3p contributes to the tumor-suppressive effects of miR-140 by reducing breast cancer proliferation and migration. BMC Genomics. 2016 Aug 8;17:566. | ||||
| REF 4 | The highly expressed 5'isomiR of hsa-miR-140-3p contributes to the tumor-suppressive effects of miR-140 by reducing breast cancer proliferation and migration. BMC Genomics. 2016 Aug 8;17:566. | ||||
| REF 5 | GPC1 exosome and its regulatory miRNAs are specific markers for the detection and target therapy of colorectal cancer.J Cell Mol Med. 2017 May;21(5):838-847. | ||||
| REF 6 | MicroRNA-22 and microRNA-140 suppress NF-B activity by regulating the expression of NF-B coactivators.Biochem Biophys Res Commun. 2011 Aug 12;411(4):826-31. | ||||
| REF 7 | MiR-140-3p suppressed cell growth and invasion by downregulating the expression of ATP8A1 in non-small cell lung cancer.Tumour Biol. 2016 Mar;37(3):2973-85. | ||||
| REF 8 | MicroRNA-140-3p inhibits proliferation, migration and invasion of lung cancer cells by targeting ATP6AP2. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12845-52. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.