Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T85273 Target Info
Target Name Forkhead box protein M1 (FOXM1)
Synonyms Winged-helix factor from INS-1 cells; Winged helix factor from INS-1 cells; WIN; Transcription factor Trident; MPP2; MPM-2 reactive phosphoprotein 2; M-phase phosphoprotein 2; Hepatocyte nuclear factor 3 forkhead homolog 11; HNF-3/fork-head homolog-11; HNF-3/fork-head homolog 11; HFH11; HFH-11; Foxm1b; Foxm1; Forkhead-related protein FKHL16; Forkhead Box (Fox) m1b; FKHL16
Target Type Literature-reported Target
Gene Name FOXM1
UniProt ID
Q08050
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-370-3p miRNA Info
miRNA Mature AC
MIMAT0000722
Sequence gccugcugggguggaaccuggu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-370 precursor decreased reporter activity in K562 cells, which strongly indicates that FoxM1 is a target for miR-370. [4]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
miRNA Mature ID hsa-miR-134-5p miRNA Info
miRNA Mature AC
MIMAT0000447
Sequence ugugacugguugaccagagggg
miRNA Species Homo sapiens
Regulation Mechanism miR-134 directly targets FOXM1 by binding to its 3'UTR. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Western Blot [6]
Representative Target(s) Regulated by This miRNA Angiopoietin-related protein 4 (ANGPTL4) Target Info
ANGL4_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-149-5p miRNA Info
miRNA Mature AC
MIMAT0000450
Sequence ucuggcuccgugucuucacuccc
miRNA Species Homo sapiens
Regulation Mechanism miR-149 directly targeted FOXM1 and overexpression of miR-149 in H1299 cells significantly decreased the protein level of FOXM1. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism FOXM1 is negatively regulated by miR-204. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-216b-5p miRNA Info
miRNA Mature AC
MIMAT0004959
Sequence aaaucucugcaggcaaauguga
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-216b markedly repressed the luciferase activity of reporter plasmids containing the FOXM1 3'UTR. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [11]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-630 miRNA Info
miRNA Mature AC
MIMAT0003299
Sequence aguauucuguaccagggaaggu
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR 630 significantly decreased EMT and properties of migration and invasion of GC cells by regulating the expression of FOXM1. [12]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [12]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-24-1-5p miRNA Info
miRNA Mature AC
MIMAT0000079
Sequence ugccuacugagcugauaucagu
miRNA Species Homo sapiens
Regulation Mechanism Forkhead box protein M1 (FOXM1) is a direct target gene of miR-24-1. [13]
Evidence Score (E-score) 1 +
1 Western Blot [13]
Representative Target(s) Regulated by This miRNA Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
Hepatocyte nuclear factor 4-alpha (HNF4A) Target Info
HNF4A_HUMAN
miRNA Mature ID hsa-miR-509-3-5p miRNA Info
miRNA Mature AC
MIMAT0004975
Sequence uacugcagacguggcaaucaug
miRNA Species Homo sapiens
Regulation Mechanism miR-509-5p binds to the 3' untranslational region of FOXM1 mRNA. [14]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [14]
Representative Target(s) Regulated by This miRNA Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
Polo-like kinase 1 (PLK1) Target Info
PLK1_HUMAN
miRNA Mature ID hsa-miR-671-5p miRNA Info
miRNA Mature AC
MIMAT0003880
Sequence aggaagcccuggaggggcuggag
miRNA Species Homo sapiens
Regulation Mechanism miR-671-5p directly regulates FOXM1 expression by binding to its 3' UTR. [15]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [15]
Representative Target(s) Regulated by This miRNA Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
References  Top
REF 1 miR-370 targeted FoxM1 functions as a tumor suppressor in laryngeal squamous cell carcinoma (LSCC). Biomed Pharmacother. 2014 Mar;68(2):149-54.
REF 2 MicroRNA-370 directly targets FOXM1 to inhibit cell growth and metastasis in osteosarcoma cells. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10250-60.
REF 3 FoxM1 is overexpressed in Helicobacter pylori-induced gastric carcinogenesis and is negatively regulated by miR-370. Mol Cancer Res. 2013 Aug;11(8):834-44.
REF 4 The tumor suppressive role of miRNA-370 by targeting FoxM1 in acute myeloid leukemia. Mol Cancer. 2012 Aug 17;11:56.
REF 5 miR-134 inhibits epithelial to mesenchymal transition by targeting FOXM1 in non-small cell lung cancer cells. FEBS Lett. 2012 Oct 19;586(20):3761-5.
REF 6 The miR-134 attenuates the expression of transcription factor FOXM1 during pluripotent NT2/D1 embryonal carcinoma cell differentiation. Exp Cell Res. 2015 Jan 15;330(2):442-50.
REF 7 MicroRNA-149 Increases the Sensitivity of Colorectal Cancer Cells to 5-Fluorouracil by Targeting Forkhead Box Transcription Factor FOXM1. Cell Physiol Biochem. 2016;39(2):617-29.
REF 8 miR-149 Inhibits Non-Small-Cell Lung Cancer Cells EMT by Targeting FOXM1. Biochem Res Int. 2013;2013:506731.
REF 9 miR-204 inhibits invasion and epithelial-mesenchymal transition by targeting FOXM1 in esophageal cancer. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12775-83.
REF 10 microRNA-216b inhibits cell proliferation and migration in human melanoma by targeting FOXM1 in vitro and in vivo. Cell Biol Int. 2017 Dec;41(12):1272-1282.
REF 11 Breast tissue-based microRNA panel highlights microRNA-23a and selected target genes as putative biomarkers for breast cancer. Transl Res. 2015 Mar;165(3):417-27.
REF 12 MicroRNA-630 Suppresses Epithelial-to-Mesenchymal Transition by Regulating FoxM1 in Gastric Cancer Cells. Biochemistry (Mosc). 2017 Jun;82(6):707-714.
REF 13 Tumour-suppressive microRNA-24-1 inhibits cancer cell proliferation through targeting FOXM1 in bladder cancer. FEBS Lett. 2014 Aug 25;588(17):3170-9.
REF 14 The Tumor Suppressive Role of MiRNA-509-5p by Targeting FOXM1 in Non-Small Cell Lung Cancer. Cell Physiol Biochem. 2016;38(4):1435-46.
REF 15 miR-671-5p inhibits epithelial-to-mesenchymal transition by downregulating FOXM1 expression in breast cancer. Oncotarget. 2016 Jan 5;7(1):293-307.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.