Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T65019 Target Info
Target Name Matrix metalloproteinase-14 (MMP-14)
Synonyms Membrane-type-1 matrix metalloproteinase; Membrane-type matrix metalloproteinase 1; MTMMP1; MT1MMP; MT1-MMP; MT-MMP 1; MMP-X1
Target Type Clinical trial Target
Gene Name MMP14
Biochemical Class Peptidase
UniProt ID
P50281
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Reporter Assay [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [3]
2 PAR-CLIP [4]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 downregulation promoted invasion and metastasis through inducing ECM remodeling and EMT by directly targeting MMP14. [5]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-10a-5p miRNA Info
miRNA Mature AC
MIMAT0000253
Sequence uacccuguagauccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism Matrix metalloproteinase 14 (MMP14) was validated as target gene of miR-10a. [7]
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR of MMP14 was the directed target of miR-133b. [8]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-143-3p miRNA Info
miRNA Mature AC
MIMAT0000435
Sequence ugagaugaagcacuguagcuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [9]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Regulation Mechanism miR-150-5p directly targets matrix metalloproteinase 14 (MMP14) and inhibits its expression. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [10]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
References  Top
REF 1 miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.
REF 2 Therapeutic Potential of Mesenchymal Cell-Derived miRNA-150-5p-Expressing Exosomes in Rheumatoid Arthritis Mediated by the Modulation of MMP14 and ... J Immunol. 2018 Oct 15;201(8):2472-2482.
REF 3 Downregulation of microRNA-193a-3p is involved in invertebral disc degeneration by targeting MMP14. J Mol Med (Berl). 2016 Apr;94(4):457-68.
REF 4 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 5 MicroRNA-22 inhibits tumor growth and metastasis in gastric cancer by directly targeting MMP14 and Snail. Cell Death Dis. 2015 Nov 26;6:e2000.
REF 6 Long non-coding RNA MALAT1 acts as a competing endogenous RNA to promote malignant melanoma growth and metastasis by sponging miR-22. Oncotarget. 2016 Sep 27;7(39):63901-63912.
REF 7 miR-10a suppresses colorectal cancer metastasis by modulating the epithelial-to-mesenchymal transition and anoikis. Cell Death Dis. 2017 Apr 6;8(4):e2739.
REF 8 MicroRNA-133b inhibits cell migration and invasion by targeting matrix metalloproteinase 14 in glioblastoma. Oncol Lett. 2015 Nov;10(5):2781-2786.
REF 9 miR-143 down-regulates TLR2 expression in hepatoma cells and inhibits hepatoma cell proliferation and invasion. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12738-47.
REF 10 miR-150-5p inhibits hepatoma cell migration and invasion by targeting MMP14. PLoS One. 2014 Dec 30;9(12):e115577.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.