Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T60213 Target Info
Target Name Bone morphogenetic protein receptor (BMPR2)
Synonyms PPH1; Bone morphogenetic protein receptor type-2; Bone morphogenetic protein receptor type II; BMPR-II; BMPR-2; BMP type-2 receptor; BMP type II receptor
Target Type Literature-reported Target
Gene Name BMPR2
Biochemical Class Kinase
UniProt ID
Q13873
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-21-5p by LNA Antisense miRNA Oligonucleotides resulted in the changed mRNA level of target BMPR2. [3]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; qRT-PCR [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-17-5p by mature miRNA precursor transfection resulted in the decreased protein level of target BMPR2. [3]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [5]
2 Luciferase Reporter Assay [3]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism BMPR2 is a direct target of miR-100. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [7]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [8]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-135b-5p miRNA Info
miRNA Mature AC
MIMAT0000758
Sequence uauggcuuuucauuccuauguga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism BMPR2 is a target of miR-181c. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism A reporter gene system showed that BMPR2 is directly targeted by miR-20a. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-302c-3p miRNA Info
miRNA Mature AC
MIMAT0000717
Sequence uaagugcuuccauguuucagugg
miRNA Species Homo sapiens
Regulation Mechanism BMPRII Is a Target of miR-302c. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [11]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-490-5p miRNA Info
miRNA Mature AC
MIMAT0004764
Sequence ccauggaucuccaggugggu
miRNA Species Homo sapiens
Regulation Mechanism miR490 directly targets bone morphogenetic protein receptor type 2 (BMPR2). [12]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [12]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
PI3-kinase alpha (PIK3CA) Target Info
PK3CA_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism Ectopic overexpression of miR-19 resulted in a strong reduction of the BMPR2 protein. []
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
References  Top
REF 1 MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer Res. 2008 Oct 1;68(19):8164-72.
REF 2 BMPRII is a direct target of miR-21. Acta Biochim Biophys Sin (Shanghai). 2009 Jul;41(7):618-23.
REF 3 Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33.
REF 4 miR-21 regulates chronic hypoxia-induced pulmonary vascular remodeling. Am J Physiol Lung Cell Mol Physiol. 2012 Mar 15;302(6):L521-9.
REF 5 Silencing of the miR-17~92 cluster family inhibits medulloblastoma progression. Cancer Res. 2013 Dec 1;73(23):7068-78.
REF 6 Interleukin-6 modulates the expression of the bone morphogenic protein receptor type II through a novel STAT3-microRNA cluster 17/92 pathway. Circ Res. 2009 May 22;104(10):1184-91.
REF 7 MicroRNA-100 regulates osteogenic differentiation of human adipose-derived mesenchymal stem cells by targeting BMPR2. FEBS Lett. 2012 Jul 30;586(16):2375-81.
REF 8 MicroRNA expression profiling in HCV-infected human hepatoma cells identifies potential anti-viral targets induced by interferon-. PLoS One. 2013;8(2):e55733.
REF 9 MiR-135b is a direct PAX6 target and specifies human neuroectoderm by inhibiting TGF-/BMP signaling. EMBO J. 2014 Jun 2;33(11):1271-83.
REF 10 Roles of miR-1-1 and miR-181c in ventricular septal defects. Int J Cardiol. 2013 Sep 30;168(2):1441-6.
REF 11 Inhibition of microRNA-302 (miR-302) by bone morphogenetic protein 4 (BMP4) facilitates the BMP signaling pathway. J Biol Chem. 2012 Nov 9;287(46):38656-64.
REF 12 MicroRNA expression profiles in human adipose-derived stem cells during chondrogenic differentiation. Int J Mol Med. 2015 Mar;35(3):579-86.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.