Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T58921 Target Info
Target Name Peroxisome proliferator-activated receptor gamma (PPAR-gamma)
Synonyms PPAR-gamma; Nuclear receptor subfamily 1 group C member 3; NR1C3
Target Type Successful Target
Gene Name PPARG
Biochemical Class Nuclear hormone receptor
UniProt ID
P37231
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130 interacts with the PPARG and 3'UTR, thereby repressing PPAG mRNA and protein levels. [2]
Evidence Score (E-score) 4 +
1 ChIP; ELISA; EMSA; Immunofluorescence; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 GFP Reporter Assay; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Microarray; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-27b-3p miRNA Info
miRNA Mature AC
MIMAT0000419
Sequence uucacaguggcuaaguucugc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-27b-3p by mature miRNA mimics tranfection resulted in the changed mRNA level of target PPARG. [5]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR [5]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
3 qRT-PCR; Western Blot [7]
Representative Target(s) Regulated by This miRNA Adenosine A2b receptor (ADORA2B) Target Info
AA2BR_HUMAN
Albendazole monooxygenase (CYP3A4) Target Info
CP3A4_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism miR-130 interacts with the PPARG and 3'UTR, thereby repressing PPAG mRNA and protein levels. [2]
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; Western Blot [2]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Upregulation of BMP signaling by miR-20a via targeting PPAR. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARG, Bambi and Crim1. [10]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [10]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism PPARgamma is a Target of miR-27a. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 miR-142-5p and miR-130a-3p are regulated by IL-4 and IL-13 and control profibrogenic macrophage program. Nat Commun. 2015 Oct 5;6:8523.
REF 2 miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression. Mol Cell Biol. 2011 Feb;31(4):626-38.
REF 3 miR-130a regulates macrophage polarization and is associated with non-small cell lung cancer. Oncol Rep. 2015 Dec;34(6):3088-96.
REF 4 MicroRNA-130a expression is decreased in Xinjiang Uygur patients with type 2 diabetes mellitus. Am J Transl Res. 2015 Oct 15;7(10):1984-91.
REF 5 microRNA miR-27b impairs human adipocyte differentiation and targets PPARgamma. Biochem Biophys Res Commun. 2009 Dec 11;390(2):247-51.
REF 6 MiR-27b targets PPAR to inhibit growth, tumor progression and the inflammatory response in neuroblastoma cells. Oncogene. 2012 Aug 16;31(33):3818-25.
REF 7 Elevation of miR-27b by HPV16 E7 inhibits PPAR expression and promotes proliferation and invasion in cervical carcinoma cells. Int J Oncol. 2015 Nov;47(5):1759-66.
REF 8 MiR-130b promotes obesity associated adipose tissue inflammation and insulin resistance in diabetes mice through alleviating M2 macrophage polarization via repression of PPAR-. Immunol Lett. 2016 Dec;180:1-8.
REF 9 MiRNA-20a promotes osteogenic differentiation of human mesenchymal stem cells by co-regulating BMP signaling. RNA Biol. 2011 Sep-Oct;8(5):829-38.
REF 10 miRNA-mediated functional changes through co-regulating function related genes. PLoS One. 2010 Oct 22;5(10):e13558.
REF 11 Hypoxia mediates mutual repression between microRNA-27a and PPAR in the pulmonary vasculature. PLoS One. 2013 Nov 14;8(11):e79503.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.