Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35824 Target Info
Target Name Matrix metalloproteinase-16 (MMP-16)
Synonyms Membrane-type-3 matrix metalloproteinase; Membrane-type matrix metalloproteinase 3; MTMMP3; MT3MMP; MT3-MMP; MT-MMP 3; MMPX2; MMP-X2; C8orf57
Target Type Literature-reported Target
Gene Name MMP16
Biochemical Class Peptidase
UniProt ID
P51512
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-31-5p resulted in the decreased protein level of target MMP16. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-155 directly targets MMP-16 (MT3-MMP), an activator of MMPs. [5]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-328-3p miRNA Info
miRNA Mature AC
MIMAT0000752
Sequence cuggcccucucugcccuuccgu
miRNA Species Homo sapiens
Regulation Mechanism Transfection of SP cells with miR-328 mimic suppressed the luciferase activity of the reporter vectors containing the 30-UTR of wild-type MMP16,. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
miRNA Mature ID hsa-miR-145-3p miRNA Info
miRNA Mature AC
MIMAT0004601
Sequence ggauuccuggaaauacuguucu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 functions as a tumor metastasis suppressor gene by down-regulating MMP16. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-16 (MMP-16) Target Info
MMP16_HUMAN
Metastasis adhesion protein (MTDH) Target Info
LYRIC_HUMAN
References  Top
REF 1 miR-146b-5p inhibits glioma migration and invasion by targeting MMP16. Cancer Lett. 2013 Oct 10;339(2):260-9.
REF 2 Inhibitory effects of miR-146b-5p on cell migration and invasion of pancreatic cancer by targeting MMP16. J Huazhong Univ Sci Technolog Med Sci. 2011 Aug;31(4):509.
REF 3 microRNA-146b inhibits glioma cell migration and invasion by targeting MMPs. Brain Res. 2009 May 7;1269:158-65.
REF 4 A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Cell. 2009 Jun 12;137(6):1032-46.
REF 5 MiR-155 inhibits cell migration of human cardiomyocyte progenitor cells (hCMPCs) via targeting of MMP-16. J Cell Mol Med. 2012 Oct;16(10):2379-86.
REF 6 MicroRNA expression profiling identifies miR-328 regulates cancer stem cell-like SP cells in colorectal cancer. Br J Cancer. 2012 Mar 27;106(7):1320-30.
REF 7 MicroRNA-145 Suppresses Osteosarcoma Metastasis via Targeting MMP16. Cell Physiol Biochem. 2015;37(6):2183-93.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.