miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-145-3p | ||||
| miRNA Stemloop AC | MI0000461 | ||||
| miRNA Stemloop ID | hsa-mir-145 | ||||
| Sequence | ggauuccuggaaauacuguucu | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-16 (MMP-16) | Literature-reported Target | Target Info | [1] | |
| Metastasis adhesion protein (MTDH) | Literature-reported Target | Target Info | [2] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Preclinical Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase epsilon-1 | Regulated Protein | [4] | ||
| References | |||||
| REF 1 | MicroRNA-145 Suppresses Osteosarcoma Metastasis via Targeting MMP16. Cell Physiol Biochem. 2015;37(6):2183-93. | ||||
| REF 2 | Dual-strand tumor-suppressor microRNA-145 (miR-145-5p and miR-145-3p) coordinately targeted MTDH in lung squamous cell carcinoma. Oncotarget. 2016 Nov 1;7(44):72084-72098. | ||||
| REF 3 | Peroxisome proliferator-activated receptor- (PPAR-) agonist inhibits collagen synthesis in human hypertrophic scar fibroblasts by targeting Smad3 via miR-145. Biochem Biophys Res Commun. 2015 Mar 27;459(1):49-53. | ||||
| REF 4 | Targeting oncogenic PLCE1 by miR-145 impairs tumor proliferation and metastasis of esophageal squamous cell carcinoma.Oncotarget. 2016 Jan 12;7(2):1777-95. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.